SGN Marker C2_At3g06580

SGN-M4654
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309509 (SGN)
125989 (CGN)
---
Lycopersicon CombinedSingleSGN-U226619---
ArabidopsisSingleAt3g06580 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42210)
Chromosome
1
Position
54.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43776
Forward primer (5'-3')
GCCAAGTTGAAAGGGATAGATGT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38433)
Chromosome
1
Position
30.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39677
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
300
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
170
Solanum pennellii TA56
270
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26064)
Chromosome
3
Position
2.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10976
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10977
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10978
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13154
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13155
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13156
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13157
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13158
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13159
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13160
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13161
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 320
Approximate temperature
55°C
  
PCR data   Exp. ID 13162
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13163
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13164
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13165
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13166
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13167
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 32998
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32999
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33000
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33001
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10979
Forward primer (5'-3')
TGCTCAACTCACATGTGAGTGTGAAAG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 170
Solanum pennellii LA716: 270
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAACCCAGATTTTGCCATAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g06580 was used as an overgo probe on plate 13 [well C4]

Plausible BAC Matches:   P252C11,   P218J06,   P050N22,   P137E03,   P032K04,   P113G22,   P235G07,   P115H10,   P057E13,   P096C10,   P286L06,   P163P10

 Overgo Sequences

A sequence
CTCACATGTGAGTGTGAAAGGCAC
B sequence
CAGACTGAGTCCCAATGTGCCTTT
AB sequence
CTCACATGTGAGTGTGAAAGGCACATTGGG
Marker sequence
ATGGCTAGACACGAGGAATTACCAATTCCAATTTTCTCTGATCTTGAACC
TGTTTATGGTAGTGGATCACAGCTTGAAGAGGCTCAACTTCGATTCAAGA
ATTTGAAAGCCAAGTTTATAGACTTATTTGGCCAATCCCCTCATGTCTAC
GCTCGATCCCCAGNNNNNGGAGAGTGAATCTGATTGGAGAACACATAGAC
TATGAGGGTTACTCTGTTTTGCCTATGGCAATTCGGCAAGATACAATTGT
GGCTATACGAAAACACGACTCTAGTGAACCTCAGAAACTTCTTAGAATTG
CCAATGTGAATAGTGATAAGTACTCCTTGTGTACTTACCCTGCTGATCCT
CTACAGNNNNNGAGGTTGATCTGAAGAATCACAGATGGGGTCATTATTTC
ATTTGTGGNNNNNGTACAAGGGTTTCTATGAATATGCCAAGTTGAAAGGG
ATAGATGTTGGTAAACCTGTTGGACTTGATGTTATTGTTGATGGTACAGT
TCCTACAGNNNNNGGTCTGGACTTTCGAGCTCTGCAGCATTTGTTTGCTC
TTCCTTTATTGCTATAATGGCTTCAATTGGTGTTAACATGCCCAAGNNNN
NAAAGAAATTGCTCAACTCACATGTGAGTGTGAAAGGCACATTGGGACTC
AGTCTGGTGGAATGGATCAGNNNNNGCCATCTCTGTTATGGCAAAATCTG
GGTTTGCTGAGCTGATTGACTTCAATCCTATACGTGCAACTGATGTACAA
CTGCCTGATGGTGGCACTTTTGTGATAGCCCATTCATTAGCTGAATCACA
AAAAGCAGTTACTGCTGCAGTTAACTATAATAATCGGGTTGTTGAATGCC
GACTAGCTGCTNNNNNATTGTACTGGGCATTAAGCTGGGGATGGAACCTA
AGGAGGCGATATCTAGTGTAAAAACTCTTTCTGATGTTGAAGGGTTGTGC
GTATCATTTGCTGGTACACACAGTTCTTCTGATCCTGTCCTTGCTGTCAA
GNNNNNGAGCTATTGCATGAGGAACCATATACCAGCGAAGATGTTGAGAA
TATCACCAAGGAAAAGGTGGAAACAATCTTTGCGGCCTCACCAACTTCTT
TGGATGTGCTTNNNNNNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g06580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4654 marker 4654
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)