SGN Marker C2_At3g44890

SGN-M4657
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310069 (SGN)
126194 (CGN)
---
Capsicum annuumSingleSGN-U202325---
Lycopersicon CombinedSingleSGN-U222824---
ArabidopsisSingleAt3g44890 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49251)
Chromosome
11
Position
49.27 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47187)
Chromosome
11
Position
78.80 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41434)
Chromosome
11
Position
102.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43410
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38530)
Chromosome
11
Position
62.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39749
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
Accessions and product sizes
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
1650
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
400+450+800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26358)
Chromosome
3
Position
16.40 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11183
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 11184
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 11185
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13282
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13283
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13284
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13285
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13286
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 13287
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13288
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33046
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33047
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 33048
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11186
Forward primer (5'-3')
ATTGGGCAAAGCTCAAATTGTGAC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 800+450+400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCTCAATTTTCTCGTCTTCCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI, HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g44890 was used as an overgo probe on plate 13 [well C9]

Plausible BAC Matches:   P335E08,   P103A03,   P176A22,   P163F21

 Overgo Sequences

A sequence
ATTGGAGCCTTCAAGGTGAAGCGT
B sequence
TTCCTTTCCCACCCTTACGCTTCA
AB sequence
ATTGGAGCCTTCAAGGTGAAGCGTAAGGGT
Marker sequence
ATGGCGTCATGGGGTTCATCTTCTTGTCTCCAAAATTACAGCTTAACCAA
AAACCCATTTTCCGAAACAGTGAAATTTTCAGAAAGAACTTCAATTTTAA
CAATTGTTGCTCAGAAAAAAGCCAAGAAAGTTCGAAAGNNNNNATAATAC
TGAAAGAGGATATTTCACAGTTGGGTAAAAAGGGAGACCTTTTGGATGTT
AAAGCTGGATTCTTTAGGAATTATTTGCTACCATTGGGCAAAGCTCAAAT
TGTGACAGCTGCACTTATCAANNNNNGGAAATGAAGATGGAAGACGAGAA
AATTGAGGCTGAAAAACAACGGNNNNNGTGAAAGATGAGGCACAACAGCT
TGCTCGAATTTTTGAAACTATTGGAGCCTTCAAGGTGAAGCGTAAGGGTG
GGAAAGGAAAGCAAATATTTGGAAGNNNNNTGTCACTGCTCAGGATCTCG
TTGATATTATAAAAGCACAGATACAGAGNNNNNGGACGTGGACAAGAAAA
TTGTCAATCTGCCTGAGATTCGAGAAACCGGAGAATATGTTGCCGAATTG
AAGCTGCATCCAGAAGTTACAGCTAGAGTAAGGTTGACAGTGTATGCCAA
TTGANNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g44890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4657 marker 4657
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)