SGN Marker C2_At5g58490

SGN-M4660
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299777 (SGN)
124026 (CGN)
---
Capsicum annuumSingleSGN-U202114---
Lycopersicon CombinedSingleSGN-U218413---
Solanum tuberosumSingleSGN-U246845---
ArabidopsisSingleAt5g58490 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38901)
Chromosome
11
Position
97.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40003
Forward primer (5'-3')
TGGTGTTTTTCATCTTGCTTCTCC
Accessions and product sizes
Solanum pennellii TA56
850
Solanum lycopersicum TA209
850
Approximate temperature
50°C
Reverse primer (5'-3')
ATACAATCAGCTGGCCAATTAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
650
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27596)
Chromosome
5
Position
23.66 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12047
Forward primer (5'-3')
TGGTGTTTTTCATCTTGCTTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACAATCAGCTGGCCAATTAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
50°C
  
PCR data   Exp. ID 12048
Forward primer (5'-3')
TGGTGTTTTTCATCTTGCTTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACAATCAGCTGGCCAATTAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
50°C
  
PCR data   Exp. ID 12049
Forward primer (5'-3')
TGGTGTTTTTCATCTTGCTTCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACAATCAGCTGGCCAATTAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
50°C
  
PCR data   Exp. ID 12050
Forward primer (5'-3')
TGGTGTTTTTCATCTTGCTTCTCC
Digested band sizes (using AluI)
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACAATCAGCTGGCCAATTAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,MspI,RsaI,DraI,TaqI,RV,HaeIII,DpnII,KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g58490 was used as an overgo probe on plate 13 [well C12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTGAATCCAGGAACTGTAATGGG
B sequence
TGGTGGGATAATAGGGCCCATTAC
AB sequence
GGTGAATCCAGGAACTGTAATGGGCCCTAT
Marker sequence
ATGGCAAACGGAGAAGGTGAAGTAGTGTGTGTTACCGGAGGCAGCGGTTT
TATTGGTTCATGGCTTGTTAGTTCTCTACTTGACCGTGGCTACACTGTTC
ACGCTACTGTTAAAGATCTCANNNNNATGATGAGAAGGAGACGAAGCATT
TACTTGGTTTAGAAGGAGCTGAATCTCGTCTTCGTCTTTATCAAATTGAT
TTGCTTGATTACGATTCAATTGTTTCTGCGATTACTGGTGCTGTTGGTGT
TTTTCATCTTGCTTCTCCTTGCATTGTTGATGAAGTTAAAGATCCTGAGN
NNNNAATGATCTTCTGTCACCAGCAATCAAAGGCACTAGTAATGTACTTA
CAGCATCAAAGGAGCTTGGTGTTAAGCGTGTGGTAGTGACTTCATCTGTA
TCGTCCATCACCCCAAATCCTAATTGGCCAGCTGATTGTATCATGAATGA
GGATTGCTGGACTGATATTGAGTACTGCAAACAGAATGGGNNNNNGTATG
GTATCCTTTGTCAAAAACACTTGCTGAAAAAGATGCTTGGAAATTTGCCA
AGGAAAAAGATTTGGATATTGTTGTGGTGAATCCAGGAACTGTAATGGGC
CCTATTATCCCACCAAGCCTTAATGCTAGCATGCAAATGATTCTTCGTCT
TCTTCAAGNNNNNGCTGCACCGATACATATAAAGATTTCTTTATGGGATT
AGTCCATGTCAAGGATGTGGCATTGGCTCATATTCTTNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g58490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4660 marker 4660
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)