SGN Marker U146437

SGN-M4664

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U146437
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40185)
Chromosome
7
Position
0.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14026
Forward primer (5'-3')
TGCACGAAGACACAGCTTGGC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 190+220
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AACCCAACCATGGCATTAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 420
Solanum lycopersicum LA925: 420
Approximate temperature
55°C
  
PCR data   Exp. ID 14026
Forward primer (5'-3')
TGCACGAAGACACAGCTTGGC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 190+220
Solanum lycopersicum LA925: 420
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AACCCAACCATGGCATTAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 420
Solanum lycopersicum LA925: 420
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U146437 was used as an overgo probe on plate 13 [well D6]

Plausible BAC Matches:   P168F12,   P095C18,   P007H24

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTCCAATAGCACCTGCACCCTTAG
B sequence
CTTTCCTCTGCAGAGTCTAAGGGT
AB sequence
TTCCAATAGCACCTGCACCCTTAGACTCTG
Marker sequence
ATGGCTTGCAGTGTTGCANNNNNGACTCTGGTTTCCTGGTCTTGGCTTCC
AAGAAAGGACCAGTTCATAGCACTAGAATTGGGCAAATTGNNNNNCTTCT
TCAGGAGCATGTTGTTTAAAGTGGGAAAGTCTACCTCAGATAAGCTCGAA
ACAGAAAGGCTGCTTAATTTACTCGAGAAAGAAAAATGTTATACAAGCTG
TTGCCGTTCCAATAGCACCTGCACCCTTAGACTCTGCAGAGGAAAGGAAT
CGATTAAGTGAAAAATATGGTTTTAGACAAATTGGAGAACCACTACCTGA
TAACGTTACAATGAGAGATATTACTGAGTCACTACCAAAGAAGNNNNNGT
ATTTGAGATTGACGATGGGAAGGCATTGAAGTCTGTTTTGATCTCAGTAA
CTTCATACACACTGGGGCTCTTCATGATTGCCAAAGCTCCATGGTATCTA
CTTCCCCTGGCCTGGGCTTGGACAGGAACAGCAGTTACAGGGNNNNNTTT
TTTGTTATAGGACATGATTGCGCTCACAAATCCTTCTCAAAGAACAAATT
ATTGGAAGATATTGTTGGAACACTAGCCTTTTTGCCATTGATATATCCCT
ATGAGCCATGGAGGTTCAAGCATGATCGGCATCACGCAAAAACAAACATN
NNNNGTTGCACGAAGACACAGCTTGGCAGCCTGTTTGGAAGGAGGAGTTC
GATTCAGTCCCTGCCCTGAGGAAGGCAATTATATTAGGTTACGGCCCTAT
TCGACCTTGGATGTCTATAGCTCACTGNNNNNGTGGCTCTGTCATTTCAA
TTTGAGTAAGTTCAGACCAAATGAAATTGACAGAGTGAAAATAAGTTTGG
GTTGCGTCTTCGCTTTTATGGCAATCGGCTGGCCACTGATAATCTGGAAA
ACAGGGATTATTGGATGGATCAAGTTCTGGTTAATGCCATGGTTGGGTTA
TCATTTTTGGNNNNNATGAGTACTTTTACAATGGTTCATCATACGGCTCC
CCACATACCCTTCAAAACTTCTGATGAGTGGAATGCTGCTCAGGCCCAGC
TGAATGGCACAGTTCACTGTGACTATCCTAGTTGNNNNNGATTGAGGTTC
TTTGTCATGATATCAATGTTCATATTCCCCACCACATATCCCCCAGAATA
CCAAGTTATAATTTACGGGCAGCTCATCAATCTCTCCAAGAGAATTGGGG
AAAGNNNNNTACCTTAACGAGGCTTCATGGAACTGGCGTCTAATGAAGAC
AATACTGACAGTATGTCATGTCTATGATAAGGAGCGGAATTATGTTCCAT
TTGATGAAATTGTCCCCGAAGAAGCCAAGCCAATCACATTCCTTAAAAAA
GTAATGCCTGACTACGCTTGA
Genomic location of U146437  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4664 marker 4664
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)