SGN Marker C2_At3g24050

SGN-M4667
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301821 (SGN)
125045 (CGN)
---
Capsicum annuumSingleSGN-U197898---
Lycopersicon CombinedMultipleSGN-U220234---
Solanum tuberosumSingleSGN-U245332---
ArabidopsisSingleAt3g24050 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46680)
Chromosome
9
Position
29.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41427)
Chromosome
3
Position
11.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43403
Forward primer (5'-3')
CAATACACTAGAGTTATATTTTTCTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38510)
Chromosome
9
Position
97.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39735
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
Accessions and product sizes
Solanum lycopersicum TA209
1700
Solanum pennellii TA56
1700
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
800+900
Solanum lycopersicum TA209
1700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26289)
Chromosome
3
Position
8.69 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11135
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 11136
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 11137
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 13261
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 13262
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13263
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 13264
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 13265
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13266
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13267
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32634
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33037
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33038
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 33039
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 11138
Forward primer (5'-3')
ATGATGAAGATGACCTTCTCAACTTCTC
Digested band sizes (using DraI)
Solanum pennellii LA716: 800+900
Solanum lycopersicum LA925: 1700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGCCTGCCCGCCATTGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI, DraI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1700
Solanum pennellii LA716: 1700
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
C2_At3g24050 was used as an overgo probe on plate 13 [well D9]

Plausible BAC Matches:   P022M02

 Overgo Sequences

A sequence
ACCCGGGTATGGTATTTGATCACC
B sequence
ACTGAAACCGGGCTATGGTGATCA
AB sequence
ACCCGGGTATGGTATTTGATCACCATAGCC
Marker sequence
ATGAAAATGGAGGATTTGGACCCAACTGCATGTTTCATGGTGGATGATGA
CCTTCTCAACTTCTCTTTGGAAGATGAAACTGTTGAAGAAGATGATGAAA
AATCAACTATTACTAGCAAAGACCCACTTTCTTATTCTTCTTCGTCTTCA
ACAAACCCTCTTGTTAGCCTTCTTCCCCACCCTGAGNNNNNTGTGTAGAG
GAAGAGTTGGAATGGCTGTCAAACAAAGATGCATTTCCAGCGATAGAGTT
TGGCATTCTTTCGGAGAACCCGGGTATGGTATTTGATCACCATAGCCCGG
TTTCAGTGCTGGAGAATAGTAGCAGCACTAGTCACAGCAGTGGCAATGGT
GTTGTTAGTGGAAATGCTTATACGAGCTGCTGCGTCAACTTAAAAGTTCC
GGTTAATTACCCTGTTCGTGCACGGAGCAAGAGAAGACGTAGAAGACGGA
GAGGTGGATTTGCTGACATGCCAAGCGAGCATTGTCTGCCGGTGACACAA
CCGAGTTTCAAGAACGTTAAGCAGCGTGAGCCATTGCTTTCTTTACCAAT
GAATTCAGCTAAGAGTGCTGCTAGCATTGGGAGGAGGTGCCAACACTGTG
GAGCCGATAAGACCCCACAATGGCGGGCAGGCCCTCTGGGGCCAAAAACA
CTGTGTAATGCTTGTGGTGTGCGCTATAAGTCAGGCAGGCTGTTACCAGA
GTATCGCCCGGCTAATAGCCCTACTTTCTCGGCTGCTGCGCATTCAAACT
CCCACCGGAAGGTTTTGGAGATGAGAAAGCATAAGATTGGTGTGGGAGGA
ATGTTGATTCATGAAGCTTGTGGATATAGGGTAGGACAGTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g24050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4667 marker 4667
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)