SGN Marker U216669

SGN-M4668

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U216669
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51055)
Chromosome
12
Position
1.35 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48991)
Chromosome
12
Position
24.46 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40206)
Chromosome
12
Position
25.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14044
Forward primer (5'-3')
TAGGGGCTGATAGGACTGCGTC
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 150
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGTCCAGCACTCTTGACATGGTTAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 14044
Forward primer (5'-3')
TAGGGGCTGATAGGACTGCGTC
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 150
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGTCCAGCACTCTTGACATGGTTAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U216669 was used as an overgo probe on plate 13 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTTCCCTGCTGCTAATCAACCTC
B sequence
TTTGCTCCAGACTCAGGAGGTTGA
AB sequence
TCTTCCCTGCTGCTAATCAACCTCCTGAGT
Marker sequence
ATGATGGCCACTGCTGCTACATGTGCATTCTTCCCTGCTGCTAATCAACC
TCCTGAGTCTGGAGCAAAATCGTCTGGAAATTTAGGAGGAAGTCTTCCTG
GAAGTATAGATACACGGGGGCTTAATGTTAAGAAGCCTTCTTTTGGGAGC
CTACAAGCTAAGGCCAATGCACAAGCACCACCTAAGGTGAATGGAACAAA
GGTAGGCGTTATGGATGGCTTCAAGAACGATGATGAGGTGATTTCTTCAC
ATCACCCAAGGACTTTTATCAACCAGTTACCTGATTGGAGCATGCTCCTC
GCTGCCATCACGACAATTTTTTTAGCTGCTGAGNNNNNAAGCAATGGATG
ATGCTTGATTGGAAGCCTAAGCGTCCTGATATGCTCGCTGATCCATTCGG
CTTAGGAAAAATTGTGCAGGATGGCTTTGTTTTCCGTCAAAATTTCAGCA
TCAGGTCCTATGAAATAGGGGCTGATAGGACTGCGTCTATAGAAACAATG
ATGAATCATTTACAGGAAACTGCTCTTAACCATGTCAAGAGTGCTGGACT
CATGCATGGTGGGTTTGGATCAACTCCAGAGATGTCCAAGAGAAATTTGA
TTTGGGTTGTTACGAAAATGCAGGTTGTGGTGGACCGTTATCCTACTTGG
GGTGATGTTGTTCAAGTAGACACTTGGGTAGCTGCATCGGGGAAAAATGG
TATGCGCAGAGATTGGCTCCTCCGCGATAGTAATACTGGGGATATATTGA
TGAGAGCTTCCAGCCAATGGGTGATGATGAATAAGGAGACGAGGAGATTA
TCTAAAATACCAGATGAGGCTCGGGCTGAAATTGAAGGTTATTTTGTTGA
CTCACCTCCTGTTNNNNNATTGATGATGACAGCAGGAAGCTGCCAAAACT
TGACGAGACAACAGCAGACTACACTCGAACTGGTTTAACTCCAAGATGGA
GTGATTTAGATGTCAACCAGCATGTTAATAATGTCAAGTACATTGGCTGG
ATNNNNNTCTTGAGAGTGCACCCATGCAAATACTAGAGGGTTGTGAGCTT
GCTGCCATGACTCTGGAGTACCGCAGGGAGTGCAGAAAGGACAGTGTGCT
TCAGTCTCTTACCTCTGTACTNNNNNCGACAAGGAAGTCGGTGACTTCAC
CGACTTTGGCAATGTCGAGTGTCAACACGTCCTTCGACTTGAAAATGGCG
GAGAGGTTGTTAAGGGACGGACTGAGTGGAGGCCGAAACTTGTCAATGGA
ATAGGGACCCTAGGCGGATTCCCAGCCGACTTCGCCTGANNNNN
Genomic location of U216669  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4668 marker 4668
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)