SGN Marker C2_At5g06430

SGN-M4669
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312128 (SGN)
125884 (CGN)
---
Capsicum annuumSingleSGN-U201754---
Lycopersicon CombinedSingleSGN-U225912---
ArabidopsisSingleAt5g06430 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46743)
Chromosome
11
Position
36.60 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46521)
Chromosome
11
Position
21.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38755)
Chromosome
10
Position
3.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39910
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
Accessions and product sizes
Solanum lycopersicum TA209
800
Solanum pennellii TA56
880
Approximate temperature
55°C
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
800
Solanum pennellii TA56
880
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27053)
Chromosome
5
Position
1.96 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11649
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 11650
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11651
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 13649
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13650
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13651
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13652
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13653
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13654
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13655
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13656
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 820
Approximate temperature
55°C
  
PCR data   Exp. ID 13657
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13658
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13659
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13660
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13661
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13662
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 33177
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33178
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33179
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33180
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11652
Forward primer (5'-3')
ATTGTTATGGCTGATGCAGAGAATG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 880
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGAAGCAAGGAACATACTTTATGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 880
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g06430 was used as an overgo probe on plate 13 [well D12]

Plausible BAC Matches:   P155L18,   P012D17,   P181N09,   P192C12,   P254M12,   P017F14,   P181O10,   P116G06,   P229I22,   P292A11,   P124P08,   P096D08,   P134O15,   P144M21,   P206A18,   P052N10,   P096N06,   P025F04,   P144K11,   P314F10,   P317B16,   P145L07,   P145L02,   P176J20,   P273M12,   P041P01,   P182E22,   P178H24,   P293J06,   P322M11,   P145N02,   P181N10,   P136O15,   P316L18,   P209L08,   P023N24

 Overgo Sequences

A sequence
ACTTGCAAAGACGGGTGTTCCTAG
B sequence
AACATGCAGTCGGCTACTAGGAAC
AB sequence
ACTTGCAAAGACGGGTGTTCCTAGTAGCCG
Marker sequence
ATGGATTCTACTTCCAAGAACTCTCCCTTTTGCTTAAAATGGCCTTGGGA
TGTTCATAACCAAAACCCAAAGAACCCTTTGCCTTGTACCTTTGAAACTC
CTTGGCTATTCAAACCATTCAAGAATCTTGGCTCTGGAGTGTTTAATTTC
ATCCAAAATATCTCAAAACCTGAACCTTTATCACCCAAATTTAATTTACA
GTCGAATGGTGGAGTTAACCAAAATAATACCTTGAAGTTGGTGAAGAAGA
AATTGACTCCTACAGAGCAAGCAGAGCTCGAGCAGAGTGCGTTAGCGTGT
GCCTTGGCCAGTGAAAAAGAGGCTACTGTAATTGAATTTTACTCCCCAAA
GTGCCGGCTCTGCAATTCGTTGGTTAATTTCGTTACTGAAGTTGAGAACA
GGAACTCTGACTGGCTCAATATTGTTATGGCTGATGCAGAGAATGACCAA
TGGTTGCCTGAGNNNNNCTTCTCCATTATGACATAAAGTATGTTCCTTGC
TTCGTTTTACTGGACAAAAACGGGAGGGCACTTGCAAAGACGGGTGTTCC
TAGTAGCCGACTGCATGTTTTGGCTGGTGTTTCTCATCTCCTCAAAATGA
GACATCCACAACACAAATAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g06430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4669 marker 4669
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)