SGN Marker CT71

SGN-M467

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT71 image not available
Forward sequence
CTTTTTTTTTTTTTTAAACACAATATGATATATATTGTACAACAAAACATTACATCATGACCAACCATTCATAGTACGTAAATGAATGGC
TTTATTCATACTTGTTACAAGCAAAGGGTCTTAATTAAGTAGCAAGATTATTATTATCTTGTCACTTAATTTCAAAAGTTTACAATAATA
ATAAATACACATAATTAAGCACTAATTAATTATTTAGTTTTGAGTCTGGGCAGCAACATATTCTTCATAAGAGCAGCAGTATTTTTTGCA
TCCATATTTGTATTTTTTGCAGCAACTGTAACATTTCTTACGTTTGCCATAGCCCTTGCCATAATAATGATCGACGTTTACTGCATTCTC
GTTATCCAATTTCACCGCATTGGTAGTCTCAGCTGCCAACTCCCTAGCTGCAACCTCAGAGCTTATCATTAAGAAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTCTTAATGATAAGCTCTGAGGTTGCAGCTAGGGAGTTGGCAGCTGAGACTACCAATGCGGTGAAATTGGATAACGAGAA
TGCAGTAAACGTCGATCATTATTATGGCAAGGGCTATGGCAAACGTAAGAAATGTTACAGTTGCTGCAAAAAATACAAATATGGATGCAA
AAAATACTGCTGCTCTTATGAAGAATATGTTGCTGCCCAGACTCAAAACTAAATAATTAATTAGTGCTTAATTATGTGTATTTATTATTA
TTGTAAACTTTTGAAATTAAGTGACAAGATAATAATAATCTTGCTACTTAATTAAGACCCTTTGCTTGTAACAAGTATGAATAAAGCCAT
TCATTTACGTACTATGAATGGTTGGTCATGATGTAATGTTTTGTTGTACAATATATATCATATTGTGTTTAAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1640853.1e-0536 (8.1% of RFLP seq)+
SGN-U1603348.9e-52162 (36.4% of RFLP seq)+
SGN-U143167418 (93.9% of RFLP seq)+
SGN-U160332360 (80.9% of RFLP seq)+
SGN-U1640853.1e-0536 (8.1% of RFLP seq)-
SGN-U1603348.8e-52162 (36.5% of RFLP seq)-
SGN-U143167418 (94.1% of RFLP seq)-
SGN-U160332360 (81.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9228)
Chromosome
9
Position
110.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9229)
Chromosome
9
Position
106.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT71 was used as an overgo probe on plate 14 [well D12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCAGCAACTGTAACATTTCTTACG
B sequence
CAAGGGCTATGGCAAACGTAAGAA
AB sequence
GCAGCAACTGTAACATTTCTTACGTTTGCC
Marker sequence
CTTTTTTTTTTTTTTAAACACAATATGATATATATTGTACAACAAAACAT
TACATCATGACCAACCATTCATAGTACGTAAATGAATGGCTTTATTCATA
CTTGTTACAAGCAAAGGGTCTTAATTAAGTAGCAAGATTATTATTATCTT
GTCACTTAATTTCAAAAGTTTACAATAATAATAAATACACATAATTAAGC
ACTAATTAATTATTTAGTTTTGAGTCTGGGCAGCAACATATTCTTCATAA
GAGCAGCAGTATTTTTTGCATCCATATTTGTATTTTTTGCAGCAACTGTA
ACATTTCTTACGTTTGCCATAGCCCTTGCCATAATAATGATCGACGTTTA
CTGCATTCTCGTTATCCAATTTCACCGCATTGGTAGTCTCAGCTGCCAAC
TCCCTAGCTGCAACCTCAGAGCTTATCATTAAGAAAAAAAAAAAA
Genomic location of CT71  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D467 marker 467
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)