SGN Marker C2_At1g14000

SGN-M4672
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311317 (SGN)
130692 (CGN)
---
Capsicum annuumSingleSGN-U203383---
Lycopersicon CombinedMultipleSGN-U215488---
Solanum tuberosumSingleSGN-U246772---
ArabidopsisSingleAt1g14000 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38097)
Chromosome
5
Position
59.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39389
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
55°C
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
650
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25001)
Chromosome
1
Position
4.80 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10021
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10022
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10023
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12424
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12425
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12426
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12427
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12428
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12429
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12430
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 12431
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 12432
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12433
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12434
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1050
Approximate temperature
55°C
  
PCR data   Exp. ID 32695
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 32696
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 32697
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 32698
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 10024
Forward primer (5'-3')
AGCGTTACATGGCTGGATCGATG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATACGTCTTTAACAATTCAATCATGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g14000 was used as an overgo probe on plate 13 [well E4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TAAAAGCTTGCTGGCGTGGAACAC
B sequence
CGTTTAACAGCTACGGGTGTTCCA
AB sequence
TAAAAGCTTGCTGGCGTGGAACACCCGTAG
Marker sequence
ATGAGTGCAAGTGAAGGGAGCTCCGGCTCATCGGCTGCCGCCGGCGCCGT
CGAAATACCGGTGGTATCGACGGAAAAGAAGAAGGAAAAGTCAAGAGTGA
GCAAGACTTCGCAAATACTCTGGCACGCTCATCATAACGATGCGACTGCC
GTAAGGAAGCTTCTAGAAGAAGATCGGACGCTTGTTCAAGCTAGAGATTA
CGATAATCGAACTCCACTCCACGTTGCAGCGTTACATGGCTGGATCGATG
TTGCAAAGTGCTTGATTGACTATGGTGCCGATGTCAACGCTCAGGATCGT
TGGAGAAACACGNNNNNCCTCTAGCCGATGCAGAAGGCGCTAAGAAATCT
GGCATGATTGAATTGTTAAAGACGTATGGTGGGCTATCTTATNNNNNGGA
CAAAATGGAAGCCATTTTGAACCAAGGCCTGTTGCCCCACCTCTACCAAA
GAAATGTGATTGGGAGATTGATCCTACTGAGCTGGACTTCTCAAATTCTG
CAATCATTGGAAAGNNNNNGGGTCTTTTGGTGAGATCTTAAAAGCTTGCT
GGCGTGGAACACCCGTAGCTGTTAAACGCATCCTCCCAAACCTGTCAGAT
GATCGATTGGTGATNNNNNTCAGGATTTCAGGCATGAGGTAAATTTGCTG
GTGAAGCTCCGTCATCCAAATATAGTGCAATTTCTTGGAGCTGTTACTGA
GAAAAAACCCTTAATGTTAATAACTGAATACTTGCGAGGGNNNNNGGCGA
TCTGCATCAGCACCTCAAGGAAAAAGGTGCTCTTACTCCATCTACAGCAG
TCAATTTTGCTATGGATATAGCAAGNNNNNAGGCATGACTTATCTTCACA
ATGAGCCAAATGTTATAATCCACAGAGATCTAAAGCCCAGNNNNNGAATG
TTCTTCTTGTCAATTCCAATGCAGACCATTTGAAAGTTGGAGATTTCGGA
TTAAGCAAACTAATCAGGGTTCAGAACTCCCATGATGTTTATAAGATGAC
TGGGGAGACAGGGAGCTNNNNNACCGCTATATGGCACCTGAAGTATTCAA
GCACCGGAAGTATGACAAGAAGGTTGATGTTTTCTCTTTCGCCATGATCT
TATATGAGNNNNNATGCTAGAGGGTGATCCACCATTATCCCACTATGAAC
CATATGAAGCAGCCAAGTATGTGGCAGAAGGACACAGGCCTATGTTCAGG
GCAAAAGGTTTTACCCCAGAATTGAAAGANNNNNGTTGGTAGAGGAATGT
TGGGCACCAGATATGAACAAGAGGCCCTCATTTTTGGATATTCTAAAAAG
ACTTGAAAAAATTAAAGAAGCTCTACCCTCAGAGCATCATTGGCACCTTT
TCACTTCATGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g14000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4672 marker 4672
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)