SGN Marker Fer

SGN-M4679
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the fe inefficient locus.

Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39094)
Chromosome
6
Position
25.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35576
Forward primer (5'-3')
CGGCTACCACCAAAATGACT
Digested band sizes (using MspI)
Solanum pennellii LA716: 375+750
Solanum lycopersicum LA925: 1250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCAACGGAGATGTCTCGAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Solanum pennellii LA716: 1250
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
Fer was used as an overgo probe on plate 13 [well F2]

Plausible BAC Matches:   P005M05,   P076C23,   P107C20,   P023B17,   P091I08,   P232A14,   P311N03,   P245P05,   P069C09,   P216L02,   P208D08,   P122K02,   P048H12,   P076N05,   P324L01,   P287H15,   P312M23,   P052L07

 Overgo Sequences

A sequence
AACGGCTACCACCAAAATGACTCC
B sequence
CGTGCCTTTGCTTGTTGGAGTCAT
AB sequence
AACGGCTACCACCAAAATGACTCCAACAAG
Marker sequence
GGGGAAAAATAAAAAAAAAATGGAGAGTGGTAATGCATCAATGGAAAATA
ATAATGTTAATGATATTGGGCTTATTAATTTCTTGGATGAGGATAATTTT
GAACAATTCATTGAGCTTATTAGGGGTGAAACTGCTGATCCTATTGTAAA
TTTTTGCCCAAACTATGATTGTGAACATATGACAGGTTGTTTTTCCGCAG
CCAATGCCCAATTTGAGCCAATATTATCGTCGATGGATTTCTATGATACA
ACATTGCCAGATCCTATTTCGCTATATAACTGCGAAATCAAGCTGGATAA
TAATGATGATGAAGACGATGATGAATCTTCTGGCACAACGGCTACCACCA
AAATGACTCCAACAAGCAAAGGCACGAGGACTGACCGGTCCAGAACTTTG
ATTTCGGAGCGCAAAAGGAGAGGAAGAATGAAGGAAAAGCTTTACGCTTT
GCGATCCTTAGTTCCTAATATCACAAAGATGGATAAAGCCTCCATCATTG
GAGATGCAATATTATACGTACAAGGACTACAAACCAAAGCAAAGAAACTT
AAAGTTGAAATAGCAGAGTTTGAGTCATCAAGTGGAATATTTCAAAATGC
AAAGAAAATGAATTTCACAACCTATTATCCAGCAATCAAGAGGATAACAA
AGATGGACATTAATCAAGTAGAAGAAAAAGGATTTTACGTGAGATTAATT
TGCAACAAAGGGCGACACATTGCAGCTTCTCTTTTCAAAGCTCTTGAGTC
TCTCAATGGATTCAATGTTCAAACTTCCAACTTGGCTACTTCTACCAATG
ATTACATTTTCACCTTCACTCTTTATGTGAGAGAATGTCATGAGGTGGAC
ATAAACTTTGGCAATTTGAAGCTATGGATAGCTAGTGCTTTTCTTAATCA
AGGGTTTGACTTCGAGACATCTCCGTTGGTCTAATATCATGTTATTATTG
TAACTTTCTAAAATACTGAACTATATTTAATTTGTATTATCATTTAGTAC
ATTATCCAAACTAAACGGGACTTTTACTTAATGAAGAGAAAACTTGTTTT
GATTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Genomic location of Fer  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4679 marker 4679
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)