SGN Marker TG73

SGN-M468

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GCTGCAGAGCTCTCTCAATGGGCGCCTTTGGAAAATAGCTTCAGAATTAGTGAATTTTATAGATATTAACAAGTTAAAGACCTTGACTAG
TATGAGTCCAAACGATTATTGATGTAGATAGAAATGACAAAGTTGAAACTTTCAAAGTGCAGTCAATGCTACAAGTCTTTATTTTATTAT
CTGTACGCTCCATGATTGAGTAAAATGCCTTTTTACTTTATTATATCAATTGATTATAATAAGTTTACGCGTGGGTAAATATTTACCCAA
GTAGTACGAGCTATTGTGTCTCAGCTTATTTTCTTATTAAGATTTAATGATTTAAATATTTAAGACTTATATCATTGAACCCATTACGTC
TTTAAAATAATGGGTTCATATTTATTGTTTATTTCAATTTTAGAGAATTTTTACACATATTTGTGCACCGCATAAAATATACTGGATTAA
GATGAACCCGATACTAAAGAGGTACACCCGTTTCAGACAATGTAACATATATAACGTGGCTTTTATCTTACATCGTTCTCAGTAAATCGT
TTGCACATC
Reverse sequence
GTATATAATGGTTGGTCCGACTTACAAGACTGCTGGCTTTGGATTCGTAAGATTCTCTCTGTATCTGGAAATGTTCAGTATCCACGGTAT
TTCACTCAATCTAATCTTTTCTTTTCCCACAACTTCTTACAGGCATTTCCAAAAGGGTCACCTTTGGTACCTGATGTATCAAGAGCAGTC
TTGAAGGTAATGGAGGGAGAGTTTATGAATAACATAATACAGAAATGGTTTGGGAATGAAACAGATTGTCCACGGATAGATGGAATGTCT
ATAACATCTGATAGTCTCACGCTGGATAGTTTTAAGGGCCTTTTCGTTACAGCTGGTGTATCGGCAGGTTCCGCTCTTCTCTTATTCTTC
CTCAACTTCCTTTATCAGAACAGAGAAATCCTAGCCACTGATGATTCAGTGTGGAAAAAGCTTTCTGCAATAGCAAAAGCTTTTGATGAA
GAGAAAGACAACTCTAATTCTATGTCAGAAAATCCATCTGAAGGGAATGGAAGCCAAACAACTACACTGTTAGCAGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1649334.3e-54206 (39.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40126)
Chromosome
6
Position
43.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9230)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG73 was used as an overgo probe on plate 5 [well C2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGATGAACCCGATACTAAAGAGG
B sequence
GTCTGAAACGGGTGTACCTCTTTA
AB sequence
AAGATGAACCCGATACTAAAGAGGTACACC
Marker sequence
GCTGCAGAGCTCTCTCAATGGGCGCCTTTGGAAAATAGCTTCAGAATTAG
TGAATTTTATAGATATTAACAAGTTAAAGACCTTGACTAGTATGAGTCCA
AACGATTATTGATGTAGATAGAAATGACAAAGTTGAAACTTTCAAAGTGC
AGTCAATGCTACAAGTCTTTATTTTATTATCTGTACGCTCCATGATTGAG
TAAAATGCCTTTTTACTTTATTATATCAATTGATTATAATAAGTTTACGC
GTGGGTAAATATTTACCCAAGTAGTACGAGCTATTGTGTCTCAGCTTATT
TTCTTATTAAGATTTAATGATTTAAATATTTAAGACTTATATCATTGAAC
CCATTACGTCTTTAAAATAATGGGTTCATATTTATTGTTTATTTCAATTT
TAGAGAATTTTTACACATATTTGTGCACCGCATAAAATATACTGGATTAA
GATGAACCCGATACTAAAGAGGTACACCCGTTTCAGACAATGTAACATAT
ATAACGTGGCTTTTATCTTACATCGTTCTCAGTAAATCGTTTGCACATC
Genomic location of TG73  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D468 marker 468
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)