SGN Marker C2_At4g39660

SGN-M4680
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204579---
Lycopersicon CombinedSingleSGN-U220644---
Solanum tuberosumSingleSGN-U247528---
ArabidopsisSingleAt4g39660 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49287)
Chromosome
4
Position
51.44 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47227)
Chromosome
4
Position
39.80 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41500)
Chromosome
12
Position
56.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43476
Forward primer (5'-3')
ACAGGGAGCCACTACTGGGGTTT
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
ACATAACCAACAAATAAGGTGCACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38729)
Chromosome
4
Position
58.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39898
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26971)
Chromosome
4
Position
18.41 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11608
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11609
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11610
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13590
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13591
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13592
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13593
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13594
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13595
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13596
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13597
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13598
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13599
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13600
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13601
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13602
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13603
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33153
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33154
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33155
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33156
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11611
Forward primer (5'-3')
TCCTGATATAGTTACAATGGCAAAG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTAAGTACTGCATGTCCACCAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g39660 was used as an overgo probe on plate 13 [well F4]

Plausible BAC Matches:   P075O04,   P195C08,   P098K19

 Overgo Sequences

A sequence
AGGTGGTTCTCCAATGAGGGATTG
B sequence
GACCGGAAAAATGCCTCAATCCCT
AB sequence
AGGTGGTTCTCCAATGAGGGATTGAGGCAT
Marker sequence
TTACAGAGGAAATTAATAAATGGGTGTGCCGGAATTACCAAGTTAAGGTG
GTTCTCCAATGAGGGATTGAGGCATTTTTCCGGTCAAGTGGCGGCGCCGA
CGGAATTGCCGCCGTTCGACTACCAACCAAAGCCGTATAAAGGGCCTTTG
GCTGATGCAGTGTTGGAGAAAAGAAGAAAGTTTTTGGGTCCTTCACTCTT
CTATTTCTACGAAAAACCTNNNNNCTAAATATTGTTGAAGGGAAGATGCA
ATATTTGTATGATGAGAATGGAAAACGTTATCTCGATGCTTTTGCTGGAA
TAGTTACTGTCTCATGTGGTCATTGTCATCCTGAAGTGTTGAATGCCATC
ATTGAGCAAAGCAAGCTTCTTCAACATGCTACAACCATTTATCTACATCA
TGCAATAGCCGATTTTGCCGAAGCATTGGCATCTAAGATGCCAGGAAACC
TCAAGNNNNNGTAGTATATTTTGTAAATTCAGGGACAGAAGCAAATGAAT
TAGCAATGTTGATGGCACGATTGTACAGCGGTCACTTAAATATGATTGCC
TTGAGGAATGCATATCATGGTGGAAGCTCTAACACGATTGGGCTAACTGC
TCTTAACACATGGAAGTACCCTATTCCACAGNNNNNGGTGAAATCCATCA
CGTTATGAATCCTAACCCATATCGTGGAGCATTTGGATCCGATGCTAAAC
GATATGCTGAAGATGTACAGAATCACATTGATCATGGTACTTCAGGAAAG
GTTGCTGGTTTTATTGCTGAAACAATTCAGNNNNNGGGGTTGGAGGAACA
GTTGAATTAGCCCCTGGATACTTGAAGTTGGTTTATGATATTGTTCGCAA
AGCGGGAGGCGTTTGTATTGCTGACGAAGTACAAACCGGCTTTGGTCGAA
CAGGGAGCCACTACTGGGGTTTTCAGACACAGGGTGTAACTCCTGATATA
GTTACAATGGCAAAGNNNNNGGTATTGGAAATGGCTTACCGCTTGGAGCT
GTTGTCACAACGCCAGAAATTGCAAGTGTTATGGCTCAAAAGATTCAATT
TAATACATATGGTGGAAACCCTGTTTGCTCTGCTGGTGGACATGCAGTAC
TTAAAGTTATTGAGAAGGAACAACGCCAAAAGCATTGTGCTGAGGTTGGC
TCACACTTGTTTGGGCGGCTGAGGGATCTAGAGGAAAAGAACGACANNNN
NTAATTGGAGATGTGAGAGGCAGAGGTTTGATGGTTGGTATTGAACTGGT
AACTGACAGAAAAGAGAAGACACCCGCCAAGGCAGAAACTGGAGTTCTCT
TTGAGAAGCTTAAAGNNNNNATCTTGGTGTTCTAGTAGGGAAAGGTGGTA
TACATGGAAATGTTTTCAGAATAAAGCCTCCCATGTGTTTCAGCAAGGAT
GATGCAGNNNNNATTTCCTAGTTGATGCACTGGACTATTCTCTTTCAAAG
TTGTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g39660  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4680 marker 4680
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)