SGN Marker C2_At3g04780

SGN-M4681
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302257 (SGN)
125074 (CGN)
---
Capsicum annuumSingleSGN-U197300---
Lycopersicon CombinedMultipleSGN-U213344---
Solanum tuberosumSingleSGN-U249608---
ArabidopsisSingleAt3g04780 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46654)
Chromosome
1
Position
49.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38426)
Chromosome
1
Position
98.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39671
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
Accessions and product sizes
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
1650
Approximate temperature
55°C
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1200
Solanum pennellii TA56
900
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26039)
Chromosome
3
Position
1.31 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10957
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10958
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10959
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13124
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1750
Approximate temperature
55°C
  
PCR data   Exp. ID 13125
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 13126
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 13127
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 13128
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13129
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13130
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13131
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13132
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13133
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32986
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 32987
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 2200
Approximate temperature
55°C
  
PCR data   Exp. ID 32988
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32989
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 10960
Forward primer (5'-3')
ACTATTGTCAATGCCCTCAAACAGG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCAGTTTGATGACTTGATTAAAAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g04780 was used as an overgo probe on plate 13 [well F7]

Plausible BAC Matches:   P319D11,   P089M01,   P166C09

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTGTAGACTGGTCTGGCGTCGAAT
B sequence
CCACTTTGGTTAAGGCATTCGACG
AB sequence
TTGTAGACTGGTCTGGCGTCGAATGCCTTA
Marker sequence
ATGGCTGCCGAATCTGCTTTTGCAATTCCCAAAGGCCAANNNNNGTTGAT
TTGATGGACTTTGTAGACTGGTCTGGCGTCGAATGCCTTAACCAAAGTGG
CAGCAACACTATTGTCAATGCCCTCAAACAGNNNNNGGTTACAGAGAAGA
CGAGGGCTTGAACCTGGTGAGTGATGCAGATGAACAGCTATTGATTTACA
TACCTTTTAATCAAGTCATCAAACTGCATTCAATCGTTATCAAAGGACCT
GAGGAGGAAGNNNNNGTCCTAAAACTGTGAAGCTGTTTTCTAACAAGGAG
CACATGGGATTTAGNNNNNTAATGTTAATGATTACCCTCCAAGTGACACA
GTTGTTTTATCTGAAGATAACCTCAAGNNNNNGGAAAACCAGTTACCTTG
AAGTATGTCAAGTTTCAAAATGTTCGCAGNNNNNTGTGACCATTTTTATT
GAGGATAATCAACATGATGGGGAAACTACAAATGTTCAAAAAATTGTTTT
GTATGGATCAACNNNNNGGTGGAAACAACAGATATGAAAGGCTTGAAGAA
GATTGAGGACCACTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g04780  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4681 marker 4681
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)