SGN Marker C2_At1g19140

SGN-M4682
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303267 (SGN)
120328 (CGN)
---
Capsicum annuumSingleSGN-U205310---
Lycopersicon CombinedSingleSGN-U218348---
Solanum tuberosumSingleSGN-U250893---
ArabidopsisSingleAt1g19140 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38119)
Chromosome
7
Position
23.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39407
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
Accessions and product sizes
Solanum lycopersicum TA209
850
Solanum pennellii TA56
850
Approximate temperature
55°C
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25062)
Chromosome
1
Position
6.61 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10057
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10058
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10059
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12468
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12469
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12470
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12471
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12472
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12473
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12474
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12475
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12476
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12477
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12478
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12479
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32711
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32712
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32713
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32714
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 10060
Forward primer (5'-3')
AGGCCCTTGTACTCAGTGCCTCTC
Digested band sizes (using DraI)
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCGGTTTCAGTCCATCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g19140 was used as an overgo probe on plate 13 [well F8]

Plausible BAC Matches:   P002M15,   P312N21,   P201H14,   P060E05,   P247L14,   P008J07,   P292K09,   P333K04,   P110P10,   P110D23

 Overgo Sequences

A sequence
CTGCCACCGGAAATATTCCTGATC
B sequence
ACCGGAATAGGGTTCTGATCAGGA
AB sequence
CTGCCACCGGAAATATTCCTGATCAGAACC
Marker sequence
ATGTATCGATCGGCGGCAAAGAGGTTACTACCGGCGTTTTACCGGCGACG
CCAGGATGCAGTATCATGCATTCGAACCCTAGCAGCAGACTACCCCACTC
GATTCATGACTTCAGCTGCCACCGGAAATATTCCTGATCAGAACCCTATT
CCGGTTAACCCTATTCTTCCTAGCTCTAATCCGACCGACTCTACCGCATC
ATCATCTTGGAAGGAAGAAGAAAGGACACGTTTTCAGGATACTGATGCAA
AATCTAGCTCGAGAACAAAGCGGCCTAAAGCGCATTACAAGGACGAAGAG
GCCCTTGTACTCAGTGCCTCTCTTTCTCATGTGNNNNNATTCGGCTAGGA
TGGACTGAAACCGCCATGATTGCAGGTGCAAGGGATGTCGGAGTGTCACC
TTCCATTGTTGGATCATTTCCTCGGAAAGAAGCTGCACTAGTGGAGNNNN
NTATTTTATGGACGAGTGTCTGGAAAGACTCATTGATATCATTGAATCAA
GGAACGATCTGAATAACTTAATACCTAGTGAGCGGATAGCAAAGCTTGTA
CGAATTCGCTTGGAAATGCAAACCCCTTACATATCAAAATGGCCACAAGC
TCTCAGTATACAGNNNNNGCTCAANNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g19140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4682 marker 4682
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)