SGN Marker C2_At5g12200

SGN-M4684
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311782 (SGN)
132417 (CGN)
---
Capsicum annuumSingleSGN-U204962---
Lycopersicon CombinedSingleSGN-U226142---
ArabidopsisSingleAt5g12200 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49291)
Chromosome
11
Position
47.32 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47232)
Chromosome
11
Position
70.10 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46751)
Chromosome
11
Position
84.50 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38780)
Chromosome
11
Position
53.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39922
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
Accessions and product sizes
Solanum lycopersicum TA209
150
Solanum pennellii TA56
150
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
210
Solanum pennellii TA56
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27120)
Chromosome
5
Position
3.94 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11696
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11697
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11698
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13687
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13688
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13689
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13690
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13691
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13692
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13693
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13694
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13695
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13696
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13697
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13698
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33194
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33195
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33196
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33197
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 11699
Forward primer (5'-3')
TCCTGACTTCCATTTTGCAGCAAG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 210
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCTGATTGGTGGGCTCATGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g12200 was used as an overgo probe on plate 13 [well F11]

Plausible BAC Matches:   P294F14,   P119D16,   P017I01,   P235M22,   P070D14,   P238L19,   P287F05,   P267K10,   P200A13,   P266K10,   P047M18,   P065E22,   P033K21,   P163L12,   P045J15,   P129P04

 Overgo Sequences

A sequence
AATCAGAGCAGCAGGTCATGGAAC
B sequence
AGCTGCTTGAAGAGCTGTTCCATG
AB sequence
AATCAGAGCAGCAGGTCATGGAACAGCTCT
Marker sequence
ATGAGTATTGACGCGATGGAAGAAATTGCCAGAGCTCGGAAGTCAGNNNN
NGTCAAAGAATTGTTGGGGAGCCAGTCGTTTCAGGTTTACTTCTTAATGA
TTCAGTACTTTGGGATCCTGACTTCCATTTTGCAGCAAGNNNNNGTACGT
CATGAGCCCACCAATCAGAGCAGCAGGTCATGGAACAGCTCTTCAAGCAG
CTCTTGCTGCAGGGGTTCTGCAGNNNNNCTGGTAGGAACTGATCACTGCA
CCTTCAACTCAACTCAGAAAGCGCTAGGAATTGGTGATTTCCGGAAAATA
CCAAATGGTGTTAATGNNNNNGTATGGAGGAGAGAATGCATTTGGTTTGG
AATACAATGGTGNNNNNGCTTCTGGTCAGATATCTGTCACTGATTATGTT
CGCATAACAAGCACAGAATGNNNNNTGCTCGGATTTTCAATATCTATCCA
AGGAAGGGAGCAATACTTGTTGGGTCTGATGCAGATATAATCATTTTAAA
TCCCAATTCAAGCTTCAAGATTAGTTCAAAGTCACACCATTATAGGACAG
ATACCAATGTCTATGAGGGTTGGACAGGCATGNNNNNGGAAAGGTTGAAA
CTACAATTGCAGGAGGAAGGGTTGTTTGGGAAAATGATGAGCTGAAAGTC
ATCCCTGGTGCTGGCAAGTACATTGAAATGCCACCTTTCAGTTATCTTTT
TGACGGGATAGACAAGGCAGATGCAAAGTACCTCTCTTCCTTAAGAGCAC
CCGTAGAACGATCAACGACTTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g12200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4684 marker 4684
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)