SGN Marker C2_At4g22260

SGN-M4685
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302905 (SGN)
121182 (CGN)
---
Capsicum annuumSingleSGN-U205149---
Lycopersicon CombinedSingleSGN-U218630---
Solanum tuberosumSingleSGN-U262956---
ArabidopsisSingleAt4g22260 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42241)
Chromosome
11
Position
5.00 cM
Confidence
I(LOD2)
Protocol
PCR


Eggplant-COSII

PCR data   Exp. ID 43808
Forward primer (5'-3')
CACGTTGAGCAATGCATCAGCATTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41481)
Chromosome
12
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43457
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38669)
Chromosome
11
Position
37.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39846
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
650
Approximate temperature
55°C
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
100
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26769)
Chromosome
4
Position
11.77 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11460
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11461
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11462
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13439
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13440
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13441
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13442
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13443
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13444
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13445
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13446
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13447
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13448
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13449
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13450
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13451
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 33103
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 33104
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33105
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33106
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11463
Forward primer (5'-3')
TCCTCTAACGGTCTAGAGAAATGGG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGAACTCTTGCAATTGTTTCCAGAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g22260 was used as an overgo probe on plate 13 [well F12]

Plausible BAC Matches:   P015A13

 Overgo Sequences

A sequence
GAAGTAATGGGAAGCCACCAGATG
B sequence
CCGTTAGAGGATGAATCATCTGGT
AB sequence
GAAGTAATGGGAAGCCACCAGATGATTCAT
Marker sequence
ATGGCGATTTCGATTTCTGCTATGAGTTTTGGAACCTCAGTTTCTTCACA
TTCTTGTTTTAGAGCTAGGAGTTTTGAGAAGTCATCAGTTTTATGCAATT
CCCAGAACCCATGTCGGTTTAATTCTGTTTTTCCGATTCGGAAATCTGAT
GGGGCTTCACGGTGTTCTGTTTCTAGNNNNNGAAATCATGTAGAGTTCGA
GCAACGTTGTTACAAGAGAATGAAGAAGAAGTGGTTGTGGAGAAATCTTT
TGCACCTAAGAGTTTTCCTGATAACGTGGGAGGGGGAAGTAATGGGAAGC
CACCAGATGATTCATCCTCTAACGGTCTAGAGAAATGGGTTATAAAGCTT
GAGCAGTCTGTAAATATCTTACTCACGNNNNNGATTCAGTGATAAAGATT
CTTGACACTTTGTATCACAACCGAAACTATGCGAGGTTTTTTGTTCTGGA
AACAATTGCAAGAGTTCCTTATTTTGNNNNNCATTTATATCGGTTCTTCA
CATGTATGAGAGCTTTGGCTGGTGGAGAAGGGCAGATTATATGAAAGTGC
ATTTTGCTGAAAGCTGGAATGAGATGCACCATTTGCTCATTATGGAANNN
NNGAATTAGGGGGAAATGCTTGGTGGTTTGATCGATTTCTTGCACAACAT
ATAGCTATATTCTATTATTTCATGACAGTCTTGATGTATGCTTTGAGCCC
GAGAATGGCATNNNNNATCATTTCTCTGAATGTGTGGAGAGCCATGCATA
CGAGACTTACGATAAATTCATCAAGGATCAAGGAGNNNNNAGGAATTGAA
GAATTTGCCCGCTCCAAAGATTGCAGTGGACTACTACACGGGAGGTGACT
TATATTTATTTGNNNNNATGAGTTTCAAACTTCACGAGAGCCTAATACTC
GAAGACCAAAAATAGNNNNNATAATCTCTATGACGTATTCATGAACATTA
GAGATGACGAAGCAGAGCATTGTAAAACGATGAAAGCCTGTCAAACTCAC
GGGAGCCTTCGTTCTCCACACACAGATCCATGCGATGATTCTGAAGATGA
TACAGGGTGTTCCGTACCTCAAGCTGATTGTATAGGTATCGTGGATTGTA
TAAAGAAGTCAGTCACCGATACTCAAGTAACCAAAAGGTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g22260  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4685 marker 4685
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)