SGN Marker r

SGN-M4686
KFG markers are Known Function Genes

SynonymsNone
Locus associations  
This marker is associated with the Phytoene synthase 1 locus.

Mapped locationsNone
Overgo hybridization and physical mapping 
r was used as an overgo probe on plate 13 [well G3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGGATGTTGAATGCCTTGAATCGG
B sequence
TCTGTTTGTAGCGGGTCCGATTCA
AB sequence
CGGATGTTGAATGCCTTGAATCGGACCCGC
Marker sequence
GGATCCATGTCTGTTGCCTTGTTATGGGTTGTTTCTCCTTGTGACGTCTC
AAATGGGACAAGTTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTG
ATTCATCGAGGCATAGGAATTTGGTGTCCAATGAGAGAATCAATAGAGGT
GGTGGAAAGCAAACTAATAATGGACGGAAATTTTCTGTACGGTCTGCTAT
TTTGGCTACTCCATCTGGAGAACGGACGATGACATCGGAACAGATGGTCT
ATGATGTGGTTTTGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCT
ACCAATGAGTTAGAAGTGAAGCCGGATGTTGAATGCCTTGAATCGGACCC
GCTACAAACAGAAAGGACGGGGGTCTCGCTGCCCGGTCAGCGAGTCGGGG
GGTCCAGGGGGGCGACGCGCTGGCCTGGGGGTCCGGGGGGGCGGAGACGC
GGCGCCGACGGTATACAATGTTGTTGTATTGGGCCCTTAATTTTCTGTTG
ATTCTGTATGTTGGGCCCAAGCCTGTTAGGGGCTAGCTTAGCACTATATA
TAGACGCTATGGGAAACCCTATTCTGTAATTCTGTTTTTGCCTCTCCATA
ATAACACTGCTCCCTCTCTTCCCGTGGACGTAGCCAATTTGTTGGTGAAC
CACGT
Genomic location of r  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4686 marker 4686
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)