SGN Marker U146899

SGN-M4687

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U146899
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40187)
Chromosome
3
Position
97.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14028
Forward primer (5'-3')
ACTTGACCGGGAAAGTGATG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1450
Solanum pennellii LA716: 550+900
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCGATCGTCTTCTCCATTGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1450
Solanum pennellii LA716: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 14028
Forward primer (5'-3')
ACTTGACCGGGAAAGTGATG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1450
Solanum pennellii LA716: 550+900
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCGATCGTCTTCTCCATTGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1450
Solanum pennellii LA716: 1450
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
U146899 was used as an overgo probe on plate 13 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAACAAATGGAGGCCGCTCTTAC
B sequence
GATCTGCTTGGCTTTGGTAAGAGC
AB sequence
AGAACAAATGGAGGCCGCTCTTACCAAAGC
Marker sequence
AAAAAGTCAATACAAGAGAGCAGAAGCCACCTGCAGAACCCAGCTTCAAA
CACCTGTTAAGCTTATTCGGCCATCTTTGATTGTGTTAATAAAGGAAGGA
GGCAATGGGATCAATGTTCAGTTCACCTCAGTTTAGCAAAGAACAAATGG
AGGCCGCTCTTACCAAAGCCAAGCAGATCGTTTCCTCTAATCCTGTTGTC
GTATTCAGTAAAACATACTGCGGATATTGCACAAGGGTGAAGAAACTTCT
TTCCCAGCTTGGTGCTACTTTTAAAGTTATTGAACTTGACCGGGAAAGTG
ATGGAGATGAGGTTCAAGCAGCATTACTAGAATGGACTAAGCAGAGGACT
GTGCCTAACGTGTTTATTGGGGGAGAACATGTTGGTGGCTGCGACAGCGT
ATTAGAGAAGCATCAACAGGGAAAGCTACTTCCCATGCTGAAGGACGCCG
CTGCTATTCCCAACAATCCTGCCAAAGTCTAGAACTCATCTATGCACTCT
AGTAGTCAACCTGACAATAAAAATGAAGTTAGAGAGTTCTGTAACTTAAC
TGCCTCCTCTCCTCTAGTTGGGGTTGTTTAATAAGACGCTGGATTTCAAG
TTCCTTTTTCTGAACATTTTCTTTTAGTACTATTTTCTATTTTTTACTTG
CCATCTGTTCCTTTGGGAAGTATATATTGTAGATTCGCGTTACAGATGCA
GTTCTGTTTCCGGCAAGAGTAAATTCGTCACTTCTGAATTTATTTCTTCC
TTTACAAATTCACAATGGAGAAGACGATCGGAACTTGCACACGAGCTAAT
TTAAA
Genomic location of U146899  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4687 marker 4687
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)