SGN Marker C2_At5g51040

SGN-M4688
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302371 (SGN)
119697 (CGN)
---
Capsicum annuumSingleSGN-U198037---
Lycopersicon CombinedMultipleSGN-U214915---
Solanum tuberosumSingleSGN-U246612---
ArabidopsisSingleAt5g51040 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38884)
Chromosome
3
Position
134.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39986
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
Accessions and product sizes
Solanum lycopersicum TA209
580+750
Solanum pennellii TA56
580+750
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
510+640
Solanum lycopersicum TA209
410+510
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27501)
Chromosome
5
Position
20.77 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11986
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11987
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11988
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13900
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13901
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13902
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13903
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13904
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13905
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13906
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13907
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13908
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13909
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13910
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33283
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33284
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33285
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33286
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11989
Forward primer (5'-3')
TCGCCGATGAATATCGATCTTTCC
Digested band sizes (using MspI)
Solanum pennellii LA716: 100
Solanum lycopersicum LA925: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAGAACAAGGTCTAGCTCCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g51040 was used as an overgo probe on plate 13 [well G5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGGGTGGGATGATATCAAGAGAGG
B sequence
TATAGGTGCATCACGGCCTCTCTT
AB sequence
AGGGTGGGATGATATCAAGAGAGGCCGTGA
Marker sequence
ATGGCGAATTTGCGAAGGGCACTTCTCTTCACCATTCCTCGAATCATCAA
TTCCTCTAAAACAGCATCTGTTGCAACCTCCACACTCCAGTCTCACAATC
TCTANNNNNCAGGCCTTTAGCTGGAACATTTTCGCGTTTTATTTCTTCTA
ATGAGACTTCATCGCCGATGAATATCGATCTTTCCGACGAAGAGAGCAAA
AGACGTTTGTTTAACAGNNNNNGCTTATTTATCGTAGTAAACAGAGAGGT
TACCTGGAGCTAGACCTTGTTCTTGGAAAATGGGTGGAGGAACATATACA
ATCCATGGATGAAAATGGAATTAAGTCCCTTGTTCATGTCCTTGACCTGN
NNNNGAGAATCCAGATTTGTGGAAGTGGCTGACTGGTCAGGAGCAACCCC
CAGATGCAATAAGCACAAATCCTNNNNNGTGTTTTCTGCTGTGCATGAAA
AGGTTATGAACAACCTTAACAATCATACTTCTCCCGAGACTCGTGCTGTT
CCAGGAAAACCTTGGGTGAGAGGGTGGGATGATATCAAGAGAGGCCGTGA
TGCACCTATAGCTGGGAACCAGTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g51040  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4688 marker 4688
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)