SGN Marker C2_At1g14310

SGN-M4689
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307639 (SGN)
130548 (CGN)
---
Lycopersicon CombinedSingleSGN-U225210---
ArabidopsisSingleAt1g14310 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41299)
Chromosome
1
Position
119.90 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43275
Forward primer (5'-3')
CGATACCTACTTTGAAGAAGTATTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38100)
Chromosome
1
Position
30.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39392
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
100
Solanum pennellii TA56
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25007)
Chromosome
1
Position
4.89 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10029
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10030
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 10031
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12449
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12450
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12451
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12452
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12453
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12454
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12455
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12456
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12457
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12458
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32593
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32703
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32704
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32705
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32706
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 32707
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 10032
Forward primer (5'-3')
TAGTGACGATACCTACTTTGAAGAAG
Digested band sizes (using AluI)
Solanum pennellii LA716: 200
Solanum lycopersicum LA925: 100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTATTGTGTCATAGGCTCCAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI
  
Accessions and product sizes
Solanum pennellii LA716: 200
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g14310 was used as an overgo probe on plate 13 [well G6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGGGTCATACACAACTCGCTGTT
B sequence
GAGGAAGAAGAGGAAGAACAGCGA
AB sequence
CTGGGTCATACACAACTCGCTGTTCTTCCT
Marker sequence
ATGGAAGCCGGTACTTTTCTCAGAGCTCTGAATCCTTTCAAATTCAGAGC
AAAATTTTCTGGGTCATACACAACTCGCTGTTCTTCCTCTTCTTCCTCTA
TCAAGATTCCCACTGGGANNNNNAAGAAATGGGGAGGAGAGCATATGATG
GATTGTTGTTGGATGCAGCAAATACACTTTTGCAATTGTCAAAGCCAGTT
GAAGAGACTTATGCTGGGATTGGCAAGAAANNNNNTATNNGNNNNNGATG
ATGGACGGCCTTTCTGGAAGCTTGTAGTTTCTGAAGCAACTGGCTGTAGT
GACGATACCTACTTTGAAGAAGTATACCAGNNNNNCACTATGCAAGTGGA
GAGGCATGGCATCTTCCAGCTGGAGCCTATGACACAATACTGATTCTGAA
ACGTTCAGGAGNNNNNTCAAACTGGCCGGTGTATCCAACTTCGACACCCG
GTTGAGGAAGATTTTGAAAGATCTGAACNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward sequence for 68, AB1 chromatogram - [View]
Forward sequence for 68, PDF chromatogram
Forward sequence for 68, plain text
1g14310Fhab-1g14310F.ab1, AB1 chromatogram - [View]
1g14310Fhab-1g14310F.pdf, PDF chromatogram
1g14310Fhab-1g14310F.txt, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward sequence for 68, AB1 chromatogram - [View]
Forward sequence for 68, PDF chromatogram
Forward sequence for 68, plain text
1g14310Fhab-1g14310F.ab1, AB1 chromatogram - [View]
1g14310Fhab-1g14310F.pdf, PDF chromatogram
1g14310Fhab-1g14310F.txt, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g14310  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4689 marker 4689
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)