SGN Marker C2_At5g04590

SGN-M4693
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302267 (SGN)
122231 (CGN)
---
Capsicum annuumSingleSGN-U205342---
Lycopersicon CombinedSingleSGN-U214723---
Solanum tuberosumMultipleSGN-U244211---
ArabidopsisSingleAt5g04590 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41506)
Chromosome
11
Position
59.20 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43482
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAACTTTCTGTTCTCTACATTTTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38745)
Chromosome
11
Position
56.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39904
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
Accessions and product sizes
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1200
Approximate temperature
58°C
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27026)
Chromosome
5
Position
1.32 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11620
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
58°C
  
PCR data   Exp. ID 11621
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
58°C
  
PCR data   Exp. ID 11622
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
58°C
  
PCR data   Exp. ID 13615
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13616
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 920
Approximate temperature
55°C
  
PCR data   Exp. ID 13617
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13618
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13619
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13620
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13621
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13622
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13623
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13624
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13625
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13626
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32647
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33161
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33162
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33163
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33164
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33165
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33166
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 11623
Forward primer (5'-3')
ATCACCACAGTCCTTGCACAGGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGACAAAGTGGAAAAGCTGGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1200
Approximate temperature
58°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g04590 was used as an overgo probe on plate 13 [well G12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGGTTCAACTCTTGGTGCATGTG
B sequence
TTCCTGTTGAGGTCACCACATGCA
AB sequence
TGGGTTCAACTCTTGGTGCATGTGGTGACC
Marker sequence
ATGACGACGTCGTTTGGAGCAGCGATCAATATCGCCGCCGTCGATGACCC
CAACCCGAAGCTACAAATTCAGAGGTTCAATGGATTGAAAAGCACCTCTA
ATTCGATTTTGCTTAGCAGACGTATCCATCGCTCATTTTCTCATTCCAAT
TCTACTTCTATTGTCCGTGCTGTATCTACGCCANNNNNGCGAAGCCAGCT
GCGGTGGAGCCCAAGCGTAGTAAGGTTGAAATCTTCAAAGAACAGAGTAA
CTTCATAAGATATCCTCTAAATGAGGAGATTCTTAATGATGCCCCAAACA
TCAATGAGGCTGCAACACAATTGATTAAGTTTCATGGAAGCTATATGCAA
TACAACAGAGACGAGCGTGGATCAAGATCATACTCATTTATGCTTCGGAC
AAAGAACCCTGGTGGTGAAGTACCGAACAAACTCTACTTAGTCATGGATG
ATCTTGCTGACCAATTTGGGATTGGGACACTCCGTTTGACAACAAGACAG
ACCTTTCAGCTGCATGGGGTCTTGAAGAAAGACCTAAAGACAGTAATGAG
TACAATCATCCACAACATGGGTTCAACTCTTGGTGCATGTGGTGACCTCA
ACAGGAACGTTCTGGCTCCAGCTGCCCCATTTGCAAAAAAAGATTATGTT
TTTGCTAAACAAACAGCTGACAACATTGCAGCACTTTTAACTCCCCAGTC
TGGATTTTACTATGACGTTTGGGTGGATGGGGAGAAATTTATGTCAGTAG
AACCTCCTGAAGTTGTGAAAGCTCGGAATGATAACTCCCATGGAACGAAC
TTTCCTGACTCACCTGAACCCATTTATGGAACTCAGTTCTTGCCAAGAAA
GTTCAAAATCGCAGTTACTGTGCCAAGTGATAACTCGGTGGACATTTTCA
CGAATGACATAGGTGTTGTTGTTGTATCTGATGAGGATGGAGAACCTCAG
GGATTCAATATATATNNNNNGTAGGTGGTGGTATGGGACGAACTCATAGG
ATGGAAACTACTTTTCCTCGTCTGGCTGAGCCATTAGGTTATGTTCCTAA
AGCGGATATACTTTATGCAGTTAAAGCTATTGTTGTTACTCAGAGAGAGA
ATGGGAGAAGAGATGATCGCAGATATAGCAGATTGAAATATTTACTCAGT
TCATGGGGGATTGAGAAGTTCCGATCTGTCACTGAACAATATTACGGAAA
GAAGTTTGAACCCTGCCGTGAATTGCCTCAATGGGAATTTAAAAGTTACT
TGGGATGGCATGAACAGNNNNNGGAGACGGTAGTTTGTTTTGTGGTCTAC
ATGTTGACAATGGTCGTGTAAAAGGAGAGATGAAGAAGGCACTCAGGGAA
GTTATTGAGAAGTATAATCTGAATGTGCGTCTCACACCCAACCAAAATAT
TATCTTGAGCAATATTCGGCAATCTTGGAAGCGCTCCATCACCACAGTCC
TTGCACAGGGTGGTTTGCTGNNNNNCAACCTAGGTTTGTCGATCCTCTCA
ATCTAACAGCAATGGCGTGCCCAGCTTTTCCACTTTGTCCTCTAGCAATC
ACTGAAGCTGAGCGTGGAATACCTGACATCCTCAAGCGTGTTAGAGCTAT
GTTTGACAAGNNNNNGTTGGTCTGAGGTTCTATGAATCCGTTGTTATAAG
GGTAACAGGTTGTCCCAATGGATGTGCTCGACCATACATGGCTGAACTTG
GATTGGTTGGAGATGGTCCAAACAGCTATCAGNNNNNATCTGGCTCGGTG
GAACTCCCAATCAAACTGTATTGGCAAGAACTTTCAAGGATAAGGTTAAG
GTTCAGGATCTTGAAAAAGTTCTGGAGCCTTTATTTTTCCATTGGAAAAG
AAAGCGACAATCTAAAGAATCGTTTGGGGAGTTCTCAAACCGCTTGNNNN
NGGATTTGAGAAACTAGGGGACTTGGTTGAGAAATGGGATGGCATCCCTG
AGTCATCATCTCGTTATAACTTAAAGCTATTTGCTGATAAAGAGACGTAT
CAAGCCATGGATGCACTTGCAAGAATACAAAATAAGAATGCCCATCAATT
GGCGATTGATGTAATTCGCAATTATGTTGCTTCCCAGCAAAATGGGAAAA
GCATGGACTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g04590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4693 marker 4693
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)