SGN Marker C2_At4g31130

SGN-M4696
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300645 (SGN)
124887 (CGN)
---
Capsicum annuumSingleSGN-U198830---
Lycopersicon CombinedMultipleSGN-U215526---
Solanum tuberosumSingleSGN-U247147---
ArabidopsisSingleAt4g31130 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46511)
Chromosome
10
Position
67.70 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41490)
Chromosome
8
Position
0.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43466
Forward primer (5'-3')
AGGTAGCCACTGGAACTTCTGCGTT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38693)
Chromosome
8
Position
3.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39869
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
Accessions and product sizes
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26860)
Chromosome
4
Position
15.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11529
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11530
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 11531
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13498
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13499
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13500
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13501
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13502
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13503
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13504
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13505
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13506
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 900+1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13507
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13508
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13509
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33122
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33123
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33124
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33125
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11532
Forward primer (5'-3')
AAAGTCAGTTCCACAAGCTGCTTTG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCGGTGATTGTAGGCCACAAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g31130 was used as an overgo probe on plate 13 [well H4]

Plausible BAC Matches:   P019H22,   P127P15,   P191A10,   P317C12,   P025I17,   P079M06,   P078L01,   P330E20,   P021H05

 Overgo Sequences

A sequence
TCTGGTTGGTGGCTTTGATGTTGG
B sequence
TCACGAGCGTTATCAGCCAACATC
AB sequence
TCTGGTTGGTGGCTTTGATGTTGGCTGATA
Marker sequence
ATGGCGATTGGTATGAAGCAGATGTCTATGATAATAGCAACCCTTGGTGT
TTTATCCTTTATATTTGGAGTTATAGCTGAAAACAAGAAGCCTGCAGCTG
GGACTGCAATATCAGGAAAAGGCGTTGTTATTTGTAAATACAAGTCTGAT
CCTACTGTTGCCTTGGGCTATTNNNNNTGTCTTTTGTTTTTCTTGCTGCA
TCTTCTGTGGCCGGTTTTCTGTCTTTGTTTTATCCGTATCAAGGAAAGTC
AGTTCCACAAGCTGCTTTGCTGAGAAACACTAGTTTCCTCGTGTTCTTAA
ANNNNNTATTGCATTGGGCACAACTGGTTTAGCAGCAACATTGTTGTTGT
GGCCTACAATCACCGAGCAACTTCATATCACACGCAACATTCATCACAAC
TTGCAGACCGATTGCCCAACTGCCAAGACCGGTCTTCTAGGTGGAGGTGC
CTTCTTGTCTCTTGATTCCGCGCTCTTCTGGTTGGTGGCTTTGATGTTGG
CTGATAACGCTCGTGAGGATTNNNNNATTTCCAAGAAACGGATATCAAGG
GCGAGCCGAAAGCAAGTTATGCAGATGATGAAATTATCAAGACCAGTGCT
TAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text

Genomic location of C2_At4g31130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4696 marker 4696
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)