SGN Marker C2_At3g58470

SGN-M4697
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299616 (SGN)
121357 (CGN)
---
Capsicum annuumSingleSGN-U197077---
Lycopersicon CombinedSingleSGN-U222473---
Solanum tuberosumMultipleSGN-U249675---
ArabidopsisSingleAt3g58470 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38583)
Chromosome
10
Position
61.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39778
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
Accessions and product sizes
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
1000
Approximate temperature
50°C
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26520)
Chromosome
3
Position
21.64 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11281
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 11282
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 11283
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 13338
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13339
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13340
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 13341
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13342
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13343
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 13344
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 13345
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 13346
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13347
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13348
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13349
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13350
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32638
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33068
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33069
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33070
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33071
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33072
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 33073
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 11284
Forward primer (5'-3')
ATTGCTTGTCCCACACTTTATGC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACTGTTCAAACCGTTTGTCATACTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g58470 was used as an overgo probe on plate 13 [well H5]

Plausible BAC Matches:   P268K08,   P021O12

 Overgo Sequences

A sequence
GACGATGATACTCCGACGTTAAGC
B sequence
CTTCTAGAGCGTGAGAGCTTAACG
AB sequence
GACGATGATACTCCGACGTTAAGCTCTCAC
Marker sequence
ATGGAGACAGCGAGAGACACCGTACAGCACGACGCCGTTCTGCCGGCCGG
CGACGATGATACTCCGACGTTAAGCTCTCACGCTCTAGAAGCACTGAAGG
AGTTCCTTGCTGAGCAGAGCCGAGCAGTTGAGGAAGCTTCGTCAGCTGCG
GCGGAGGATGACGTGGCGCTGGTATCGGAGGATTGGCGGCTAAGCCAGTT
CTGGTATAACCGTGAAACAGCTGAAACTGTCGCTAATGAAGTCCTTAATC
TCTGTCGATCGATTGATTCGCCGGCGATTGCCTGCATTGCTTGTCCCACA
CTTTATGCTTATCTCAAGNNNNNAAAATTGACCCTAATGCACCTGCACAA
ATTCTCGAGTATGACAAACGGTTTGAACAGTATGGAAGTGAGTTCACATT
CTACGACTACAACCTACCAGAAGATCTTCCTTCTTCAATGAAACACTCAT
ATCCAATAATTGTTGCAGATCCTCCTTACCTGNNNNNAGTCAGGAATGCT
TAGAGAAAGTTGCTAAAACAATTTCTTTTCTCACGAGACCAGGACAAGCC
TACTTGCTTTTACTCACAGNNNNNGTNACATACTGAATTTTATGCAGTGT
TTTACGACTTGGTCTCCCGTTGGCTGTCGTTCATCATGTTAATGGTCATT
GAATCTAGTTATTGTTTTTTAAGGATCCTTAAACAATGAATCCAGTTATN
NNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6 (2), plain text

Genomic location of C2_At3g58470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4697 marker 4697
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)