SGN Marker U153274

SGN-M4698

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U153274
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40193)
Chromosome
2
Position
120.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14033
Forward primer (5'-3')
GCGAGGATAACGGTGAGAAG
Digested band sizes (using AciI)
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 450
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCCTTTGGAGACTCCTTGT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 14033
Forward primer (5'-3')
GCGAGGATAACGGTGAGAAG
Digested band sizes (using AciI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 350
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCCTTTGGAGACTCCTTGT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
U153274 was used as an overgo probe on plate 13 [well H6]

Plausible BAC Matches:   P081J06,   P073P13,   P292L05,   P006M01,   P212M16,   P082M02,   P161K18

 Overgo Sequences

A sequence
TCAGGAGCATGTGGTACTGAGTTG
B sequence
GTGGCTCCGCATTAATCAACTCAG
AB sequence
TCAGGAGCATGTGGTACTGAGTTGATTAAT
Marker sequence
TTTTTTTAGCCATCTTTCTCTTTCTCTCTGTCTCCATTTCCAGCATATAA
TCAAAATCTCTTCACACTTTTTCATTACAGTATTTGATTCTTTATTCTCC
AATGCTCTCTTTCTTTTTTATATATACTGAAAGTAAGTAACTTTTTCCTT
CCCTACAAGCAAAGTTGTTCACTTTTCTTGATTCCTTCATTTTCTTGATT
TTTGGGTTTGTGGGTTTCTGTGTTGTTTTCGAGATCCGTTCTCTAAATGG
GGTTTATTCCAAATAGTTTTACTAACTCTGTGGAGCCTCTTCACAGTTCA
TACCCTTTAAAGACTCAAGCTTTAGCCACTGATACAGATAACCATTGTGG
AAATGAAGAGTTAAAAATCAAGTCTTTAATATACAGAATGATTTGGGATT
TTGGGTTGGCTTGTTTTGTTCCGACCCGTCGCCGGCGAGCTTCCGGCGAG
GATAACGGTGAGAAGGATGAAGGTGTTAGCAGTTTGGAGCATAATAAGGC
TTGGTTGCTTGCTGAGTCAGGAGCATGTGGTACTGAGTTGATTAATGCGG
AGCCACATTCGGTTCATTCCTCTTTTAGGTTTAGTTTTTGCTCTCAGGTT
GAGCTTGAGTCTATGAATGTTAATAAATGTTCTTCTGCCACTGTTTTGAT
GGTGAATTTGGATAACGGGTTAACTGATCCCCTGTCTAGAGAGCTAAAAT
GGAGGAAAATTCAATCACTTGAGAGGAGTATTTCTCCTGTGACTCATTCT
TTAATTAGGTTTACCTATCCTGAGATTGCTTCTGCTACTAGGAATTTTTC
AAAAGGTAGAGTTTTGGGAAGAGGAGCATTGAGCTATGTTTTCAGAGGAA
GAGTTGGATTTATGAGGACTACTGTTGCGATTAAGCGGTTAGATAGGGAA
GACAAGGAGTCTCCAAAGGCATTTTGTAGGGAGTTAATGATTGCTAGTTC
TCTTCACAACCCATACATTGTTCCTCTGGTGGGTTTTTGTATTGATCCAG
AGGAGGGTTTCTTTTTGGTATACAAGTATGTATCTGGTGGAAGTTTAGAG
CGGTATTTACATGATAAGAAGAAGAGGGGAGTGAAGGGTGGTCCAGTACT
TCCATGGTCTACGCGGTATAAGGTGGCTGTAGGCATTGCTGATTCAATCG
GGTACTTGCATTATGGCACTGAGAGGTGTGTTGTTCACAGGGACATCAAA
CCCTCCAACATTCTTCTCTCATCCAAAAAGACGCCCAAGTTGTGTGACTT
TGGTTTAGCT
Genomic location of U153274  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4698 marker 4698
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)