SGN Marker U146140

SGN-M4699

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U146140
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40184)
Chromosome
6
Position
97.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14025
Forward primer (5'-3')
TCTCCAAGCTGATTACGCCGAAGG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 350
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATCTAACCAAATTCAGTGCATCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 14025
Forward primer (5'-3')
TCTCCAAGCTGATTACGCCGAAGG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 350
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATCTAACCAAATTCAGTGCATCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U146140 was used as an overgo probe on plate 13 [well H9]

Plausible BAC Matches:   P317C17,   P182D16

 Non-Plausible BAC matches

P262M13,   P034C13,   P268F21

 Overgo Sequences

A sequence
GGGATGAATACCTTGATCTTCTCC
B sequence
TCGGCGTAATCAGCTTGGAGAAGA
AB sequence
GGGATGAATACCTTGATCTTCTCCAAGCTG
Marker sequence
ATGATCATTCCAGTGCGCTGTTTCACCTGCGGGAAGNNNNNGTTATTGGC
AACAAATGGGATGAATACCTTGATCTTCTCCAAGCTGATTACGCCGAAGG
NNNNNGGATGCACTTGATGCACTGAATTTGGTTAGATATTGCTGTCGTAG
AATGCTTATGACTCATGTTGATCTCATTGAGAAGCTTCTCAACTACAACA
NNNNNCACTGGAGAAATCTGAGGGAAGTTGA
Genomic location of U146140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4699 marker 4699
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)