SGN Marker C2_At4g38810

SGN-M4701
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300268 (SGN)
124601 (CGN)
---
Capsicum annuumSingleSGN-U200171---
ArabidopsisSingleAt4g38810 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38726)
Chromosome
1
Position
162.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39895
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
Accessions and product sizes
Solanum pennellii TA56
1500
Solanum lycopersicum TA209
1500
Approximate temperature
55°C
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
450+850
Solanum pennellii TA56
260+400+550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26965)
Chromosome
4
Position
18.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11604
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11605
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11606
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13585
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 13586
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13587
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13588
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13589
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 33152
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11607
Forward primer (5'-3')
AGGTGATGGACGGTTCAGATATAATG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 260+400+550
Solanum lycopersicum LA925: 450+850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTCTTTAAACTCAGTCTTGCTTAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,MspI,DraI,TaqI,Rv,HaeIII,HinfI,DpnII,KpnI
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g38810 was used as an overgo probe on plate 13 [well H11]

Plausible BAC Matches:   P025N22,   P090H07,   P243G09,   P199L10,   P326M21,   P332H15,   P190G10,   P213J20,   P242C17,   P094J12,   P056B15,   P093O02,   P199B16,   P188N10,   P257O20,   P066J06

 Non-Plausible BAC matches

P043P11,   P222J01,   P005I06,   P236H10,   P224I13,   P072N16,   P138H16

 Overgo Sequences

A sequence
AGGAGTTACAACCTGCTGTTGCTG
B sequence
AGGGCAACACCAATATCAGCAACA
AB sequence
AGGAGTTACAACCTGCTGTTGCTGATATTG
Marker sequence
ATGAAGTTGAAAAGTAGTGAGAGTCAGGTGATGGACGGTTCAGATATAAT
GAAGTTAGTTGGAAATGAGGCTGTGTTTAGTAACTTTGTAGATCATAAGT
TTGAAGAACTTGACATAGACAAAGACGGTAAACTTTCAGTGAAGGAGTTA
CAACCTGCTGTTGCTGATATTGGTGTTGCCCTTGGTTTACCTCCTCAAGG
TTCTTCCCCTGAATCTGATCATATCTACTCTGAGNNNNNGTTCTTCAAGA
ATTCACACATGGAAAGCAAGAGAAAGTAAGCAAGACTGAGTTTAAAGAAG
TTCTTTCAGATATTTTACTAGGAATGGCTGCTGGTCTAAAGCGAGATCCT
ATTGTACTCCTTCGTATGGATGGTGAAGATCTTCTTGAGTTCGTTAAAAG
TCCTGCATTCGAACCAGAGATGATTTCCCTGTACTCTGAGTTAGAATTGC
CTGATGGATCCCTCAAAGATTACATCATCAAGGCTTTTGAGAAGCTCACG
GTTGATCAAGGGATGCCTCCTGCATCAGACTCATGGNNNNNGTGTTGAGT
TTTGTTNNNNNGTTGATGGCNNNNNTTAACATTCATGTCTAGCTACAAAC
GAGCACTCTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g38810  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4701 marker 4701
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)