SGN Marker dwarf

SGN-M4704
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locationsNone
Overgo hybridization and physical mapping 
dwarf was used as an overgo probe on plate 14 [well E7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGCCTTCTTCTTAATTTTTCTTTC
B sequence
TAGGCCAAAAAAGGATGAAAGAAA
AB sequence
GGCCTTCTTCTTAATTTTTCTTTCATCCTT
Marker sequence
ATGGCCTTCTTCTTAATTTTTCTTTCATCCTTTTTTGGCCTATGTATCTT
TTGTACTGCTTTATTAAGATGGAATCAAGTCAAGTATAACCAAAAAAACT
TGCCCCCTGGTACTATGGGTTGGCCACTTTTTGGTGAAAC
Genomic location of dwarf  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4704 marker 4704
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)