SGN Marker U150724

SGN-M4706

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U150724
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40190)
Chromosome
2
Position
121.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14031
Forward primer (5'-3')
CCAGCGATCCTTACGTTGTT
Digested band sizes (using MspI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACACCCTTGGAACCAGGAAT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 14031
Forward primer (5'-3')
CCAGCGATCCTTACGTTGTT
Digested band sizes (using MspI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACACCCTTGGAACCAGGAAT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
50°C
  
Genomic location of U150724  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4706 marker 4706
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)