SGN Marker U143788

SGN-M4707

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U143788
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40180)
Chromosome
2
Position
70.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14022
Forward primer (5'-3')
GGGTGGCCTAATTGGTTCTT
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGGCCTTCTTGTCGATGAAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 14022
Forward primer (5'-3')
GGGTGGCCTAATTGGTTCTT
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGGCCTTCTTGTCGATGAAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
50°C
  
Genomic location of U143788  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4707 marker 4707
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)