SGN Marker U146494

SGN-M4708

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U146494
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51054)
Chromosome
2
Position
43.53 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48990)
Chromosome
2
Position
99.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40186)
Chromosome
2
Position
90.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14027
Forward primer (5'-3')
GTGAATTGTCCGGTTCTCGT
Digested band sizes (using KpnI)
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 550
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AATGCTCATCCCTTGTTTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 14027
Forward primer (5'-3')
GTGAATTGTCCGGTTCTCGT
Digested band sizes (using KpnI)
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 550
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AATGCTCATCCCTTGTTTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Genomic location of U146494  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4708 marker 4708
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)