SGN Marker TG75

SGN-M471

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
5800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GAAAAATATACAGCTCGTGTATATTTTATTTGTATAAGTAAAAGAAATAATCGCAATAAATGTGGCTTTTACTATAAAGTTCCAAATTTT
TCTATATATATGTTTTATAATATGGTAACTAATGGTTTATGGTTATTAAAAGTCACCCCTCTATGATTTATGATCCATTTTAAATAATCA
AGGAAATACCCTATGTTCAACCATACAAACCTAAGACACAAAAATAAATGAATTTTTTCAAATTGTTTTTGTTAGTTGTTGTACCAAATA
TCAAAATTTATTAAAATTTTCACAAAGGTTAAACTTTCGTTATCTTGTTGCATGCTAATCGTTAGTTAACGTATAGCTTGTCATGATAAA
GAAATTTAATTATTCAAAAATCAATTTATTAAAATTGGCTCTACTTAGTCACTGACGTGCTTCTTAACTATATATTGATATAATTAACAG
CGTGTGGGCAAATGAAATTAATATAATTTATGAAGTTTCAAT
Reverse sequence
GAAAAATATACAGCTCGTGTATATTTTATTTGTATAAGTAAAAGAAATAATCGCAATAAATGTGGCTTTTACTATAAAGTTCCAAATTTT
TCTATATATATGTTTTATAATATGGTAACTAATGGTTTATGGTTATTAAAAGTCACCCCTCTATGATTTATGATCCATTTTAAATAATCA
AGGAAATACCCTATGTTCAACCATACAAACCTAAGACACAAAAATAAATGAATTTTTTCAAATTGTTTTTGTTAGTTGTTGTACCAAATA
TCAAAATTTATTAAAATTTTCACAAAGGTTAAACTTTCGTTATCTTGTTGCATGCTAATCGTTAGTTAACGTATAGCTTGTCATGATAAA
GAAATTTAATTATTCAAAAATCAATTTATTAAAATTGGCTCTACTTAGTCACTGACGTGCTTCTTAACTATATATTGATATAATTAACAG
CGTGTGGGCAAATGAAATTAATATA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53862)
Chromosome
4
Position
69.40 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40128)
Chromosome
4
Position
72.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9236)
Chromosome
4
Position
50.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG75 was used as an overgo probe on plate 10 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCAAGGAAATACCCTATGTTCAAC
B sequence
GTCTTAGGTTTGTATGGTTGAACA
AB sequence
TCAAGGAAATACCCTATGTTCAACCATACA
Marker sequence
GAAAAATATACAGCTCGTGTATATTTTATTTGTATAAGTAAAAGAAATAA
TCGCAATAAATGTGGCTTTTACTATAAAGTTCCAAATTTTTCTATATATA
TGTTTTATAATATGGTAACTAATGGTTTATGGTTATTAAAAGTCACCCCT
CTATGATTTATGATCCATTTTAAATAATCAAGGAAATACCCTATGTTCAA
CCATACAAACCTAAGACACAAAAATAAATGAATTTTTTCAAATTGTTTTT
GTTAGTTGTTGTACCAAATATCAAAATTTATTAAAATTTTCACAAAGGTT
AAACTTTCGTTATCTTGTTGCATGCTAATCGTTAGTTAACGTATAGCTTG
TCATGATAAAGAAATTTAATTATTCAAAAATCAATTTATTAAAATTGGCT
CTACTTAGTCACTGACGTGCTTCTTAACTATATATTGATATAATTAACAG
CGTGTGGGCAAATGAAATTAATATAATTTATGAAGTTTCAAT
Genomic location of TG75  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D471 marker 471
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)