SGN Marker U176363

SGN-M4712

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U176363
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40196)
Chromosome
7
Position
0.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14035
Forward primer (5'-3')
TTCGCAATGGTTGCTGCACTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACACAGAGGATTGCATAAAGAGCATAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700+1300
Solanum pennellii LA716: 700+1100
Approximate temperature
55°C
  
PCR data   Exp. ID 14035
Forward primer (5'-3')
TTCGCAATGGTTGCTGCACTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACACAGAGGATTGCATAAAGAGCATAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700+1300
Solanum pennellii LA716: 700+1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U176363  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4712 marker 4712
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)