SGN Marker C2_At2g25950

SGN-M4714
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303864 (SGN)
123150 (CGN)
---
Capsicum annuumSingleSGN-U201087---
Lycopersicon CombinedSingleSGN-U221057---
Solanum tuberosumSingleSGN-U264694---
ArabidopsisSingleAt2g25950 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38328)
Chromosome
8
Position
23.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39586
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
110+240
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25717)
Chromosome
2
Position
11.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10665
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10666
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10667
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12988
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12989
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12990
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12991
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12992
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12993
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12994
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 12995
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12996
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12997
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12998
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32926
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32927
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32928
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10668
Forward primer (5'-3')
TGGTGGTGCTGATGGAACAAGTCC
Digested band sizes (using AluI)
Solanum pennellii LA716: 110+240
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCTTGCATAGATTGAGCATCTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g25950  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4714 marker 4714
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)