SGN Marker C2_At2g34470

SGN-M4715
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301333 (SGN)
121452 (CGN)
---
Capsicum annuumSingleSGN-U197505---
Lycopersicon CombinedSingleSGN-U219076---
Solanum tuberosumMultipleSGN-U246522---
ArabidopsisSingleAt2g34470 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38357)
Chromosome
2
Position
38.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39610
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
Accessions and product sizes
Solanum pennellii TA56
630
Solanum lycopersicum TA209
630
Approximate temperature
55°C
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
630
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25814)
Chromosome
2
Position
14.54 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10773
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 630
Approximate temperature
55°C
  
PCR data   Exp. ID 10774
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 630
Approximate temperature
55°C
  
PCR data   Exp. ID 10775
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 630
Approximate temperature
55°C
  
PCR data   Exp. ID 13014
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13015
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13016
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13017
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13018
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32621
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32938
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32939
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32940
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32941
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10776
Forward primer (5'-3')
TTGAGGGAAAAATACAGTCTTGC
Digested band sizes (using MspI)
Solanum pennellii LA716: 630
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAACTCTCCATCTTCTTTCGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 630
Solanum lycopersicum LA925: 630
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At2g34470  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4715 marker 4715
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)