SGN Marker C2_At2g22570

SGN-M4717
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307072 (SGN)
128866 (CGN)
---
Capsicum annuumSingleSGN-U200076---
Solanum tuberosumSingleSGN-U248441---
ArabidopsisSingleAt2g22570 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38317)
Chromosome
11
Position
31.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39578
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25691)
Chromosome
2
Position
9.60 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10634
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10635
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 10636
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12962
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12963
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12964
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12965
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12966
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12967
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12968
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200+850
Approximate temperature
55°C
  
PCR data   Exp. ID 12969
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12970
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12971
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12972
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 150+350
Approximate temperature
55°C
  
PCR data   Exp. ID 32915
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32916
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32917
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32918
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200+850
Approximate temperature
55°C
  
PCR data   Exp. ID 10637
Forward primer (5'-3')
ACTGAAGAGTGAGATTCCGGTGGAG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCCAGTGATACAATGAGGAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, EcoRV, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text

Genomic location of C2_At2g22570  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4717 marker 4717
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)