SGN Marker C2_At4g33250

SGN-M4718
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310651 (SGN)
132181 (CGN)
---
Capsicum annuumSingleSGN-U198940---
Lycopersicon CombinedSingleSGN-U216333---
Solanum tuberosumMultipleSGN-U245082---
ArabidopsisSingleAt4g33250 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49281)
Chromosome
7
Position
53.36 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47221)
Chromosome
7
Position
25.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41493)
Chromosome
7
Position
49.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43469
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38703)
Chromosome
7
Position
29.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39875
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
Accessions and product sizes
Solanum lycopersicum TA209
1400
Solanum pennellii TA56
1450
Approximate temperature
55°C
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1450
Solanum lycopersicum TA209
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26893)
Chromosome
4
Position
16.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11548
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1450
Approximate temperature
55°C
  
PCR data   Exp. ID 11549
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11550
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13522
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13523
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13524
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13525
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13526
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13527
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13528
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13529
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1200+1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13530
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13531
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13532
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13533
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13534
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13535
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 33130
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33131
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33132
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 33133
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11551
Forward primer (5'-3')
TCCAGATTACAGCCTGTGTCTCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1400
Solanum pennellii LA716: 1450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCGGCTCTTTGCAGCTTCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 1450
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g33250  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4718 marker 4718
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)