SGN Marker C2_At4g33985

SGN-M4720
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299937 (SGN)
124164 (CGN)
---
Capsicum annuumSingleSGN-U198292---
Lycopersicon CombinedSingleSGN-U213699---
Solanum tuberosumSingleSGN-U246513---
ArabidopsisSingleAt4g33985 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49282)
Chromosome
2
Position
46.89 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47222)
Chromosome
2
Position
133.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46733)
Chromosome
2
Position
13.70 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46516)
Chromosome
2
Position
70.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38708)
Chromosome
2
Position
118.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39878
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
Accessions and product sizes
Solanum pennellii TA56
500
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
330
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26905)
Chromosome
4
Position
16.29 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11558
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11559
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11560
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13546
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13547
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13548
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13549
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13550
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13551
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300+1031
Approximate temperature
55°C
  
PCR data   Exp. ID 13552
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13553
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1031
Approximate temperature
55°C
  
PCR data   Exp. ID 33139
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33140
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 11561
Forward primer (5'-3')
ACGATTGTCTGATACTTTTCCGGC
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 330
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGACGCACCACACAAGCAACCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI, HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text

Genomic location of C2_At4g33985  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4720 marker 4720
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)