SGN Marker C2_At1g13380

SGN-M4721
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310403 (SGN)
129710 (CGN)
---
Capsicum annuumSingleSGN-U203403---
Lycopersicon CombinedSingleSGN-U225576---
Solanum tuberosumSingleSGN-U251622---
ArabidopsisSingleAt1g13380 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132173)
Chromosome
10
Position
10.09 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Pepper-COSII   
Map version
58 (location: 41298)
Chromosome
11
Position
8.60 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43274
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38096)
Chromosome
5
Position
38.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39388
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
Accessions and product sizes
Solanum pennellii TA56
800
Solanum lycopersicum TA209
800
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
300+450
Solanum pennellii TA56
200+300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24998)
Chromosome
1
Position
4.59 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10011
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 10012
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 10013
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12401
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12402
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12403
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 12404
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12405
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12406
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12407
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12408
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12409
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12410
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12411
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12412
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12413
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12414
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 32687
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32688
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32689
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 32690
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 10014
Forward primer (5'-3')
AGGTGCTTTCTTGTTTCTTCTTTC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 300+450
Solanum pennellii LA716: 200+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGCATATCACGATACTTGGTGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g13380  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4721 marker 4721
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)