SGN Marker C2_At3g13235

SGN-M4724
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310006 (SGN)
125975 (CGN)
---
Capsicum annuumSingleSGN-U197821---
Lycopersicon CombinedMultipleSGN-U217446---
Solanum tuberosumSingleSGN-U250857---
ArabidopsisSingleAt3g13235 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132186)
Chromosome
4
Position
11.21 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49243)
Chromosome
10
Position
0.69 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46661)
Chromosome
8
Position
12.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42215)
Chromosome
4
Position
0.00 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43781
Forward primer (5'-3')
ATTCTGCTGCTGTCAAATGCTTTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41412)
Chromosome
10
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43388
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38461)
Chromosome
10
Position
0.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39701
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
Accessions and product sizes
Solanum pennellii TA56
750
Solanum lycopersicum TA209
750
Approximate temperature
55°C
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
210
Solanum pennellii TA56
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26154)
Chromosome
3
Position
4.27 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11038
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11039
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11040
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13191
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13192
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13193
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13194
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13195
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13196
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13197
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33014
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33015
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33016
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 11041
Forward primer (5'-3')
AGGTCGTATTCATGTTGCTCCAATC
Digested band sizes (using AluI)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 210
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATATCAAGTCCAAAGAGAAATTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g13235  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4724 marker 4724
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)