SGN Marker U168526

SGN-M4726

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U168526
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40195)
Chromosome
9
Position
50.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14034
Forward primer (5'-3')
GTGGGTCCTCCTCAAAATGA
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGGCAGTCCAGCAATTTAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 428
Solanum lycopersicum LA925: 428
Approximate temperature
60°C
  
PCR data   Exp. ID 14034
Forward primer (5'-3')
GTGGGTCCTCCTCAAAATGA
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGGCAGTCCAGCAATTTAAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 428
Solanum pennellii LA716: 428
Approximate temperature
60°C
  
Genomic location of U168526  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4726 marker 4726
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)