SGN Marker U144576

SGN-M4728

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U144576
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40183)
Chromosome
1
Position
115.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14024
Forward primer (5'-3')
GATTCGCTAACCTGCACCAT
Digested band sizes (using MspI)
Solanum pennellii LA716: 950
Solanum lycopersicum LA925: 1020
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACTTGCCACAAGTCCACACA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
60°C
  
PCR data   Exp. ID 14024
Forward primer (5'-3')
GATTCGCTAACCTGCACCAT
Digested band sizes (using MspI)
Solanum pennellii LA716: 950
Solanum lycopersicum LA925: 1020
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACTTGCCACAAGTCCACACA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
60°C
  
Genomic location of U144576  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4728 marker 4728
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)