SGN Marker CT203

SGN-M473

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT203 image not available
Forward sequence
GAGGAAGCGTAATAGGCCAGAGAGATATGACAGGAATGTAACTGAGAACACTTTGAAGGCCATCAAGAAAATTGATAAAATCAGAGTTGA
CAGGGAGGAGAGACATATTGCAAAGAGGATGAAAGGAAATAAAGCCAAGGAGCAGAGAGAAGCAACAAAGGAGCTCGAGCAGAGCATTCA
CATGGTCAAAGCTCCTTCTGTGCTCTTCAAAGAGCCATCACTTACACTACCTACCAAGGTCAAGGTTTTGCAAAAGCAGTCAGAGGAAAA
TCGCATGGAGGAATGAACATTTCGCTTCCCATATTCTATTTTTTCAAACTAAAAAAACACTAAATCGGTCCATACTTATTTTTGCAGTAT
GTATAACATTTTGATGACATTGACATGCTAAGCTTTCCCTTAAAAAAAAAAAAAAAAAA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1617766e-62140 (33.4% of RFLP seq)+
SGN-U1617766e-62119 (28.4% of RFLP seq)+
SGN-U146185401 (95.7% of RFLP seq)+
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43643)
Chromosome
10
Position
47.00 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43503)
Chromosome
10
Position
42.50 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43043)
Chromosome
10
Position
43.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40746)
Chromosome
10
Position
41.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39011)
Chromosome
10
Position
48.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9243)
Chromosome
10
Position
43.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9245)
Chromosome
10
Position
63.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT203 was used as an overgo probe on plate 14 [well G1]

Plausible BAC Matches:   P149M04

 Overgo Sequences

A sequence
TAAAGCCAAGGAGCAGAGAGAAGC
B sequence
CTCGAGCTCCTTTGTTGCTTCTCT
AB sequence
TAAAGCCAAGGAGCAGAGAGAAGCAACAAA
Marker sequence
GAGGAAGCGTAATAGGCCAGAGAGATATGACAGGAATGTAACTGAGAACA
CTTTGAAGGCCATCAAGAAAATTGATAAAATCAGAGTTGACAGGGAGGAG
AGACATATTGCAAAGAGGATGAAAGGAAATAAAGCCAAGGAGCAGAGAGA
AGCAACAAAGGAGCTCGAGCAGAGCATTCACATGGTCAAAGCTCCTTCTG
TGCTCTTCAAAGAGCCATCACTTACACTACCTACCAAGGTCAAGGTTTTG
CAAAAGCAGTCAGAGGAAAATCGCATGGAGGAATGAACATTTCGCTTCCC
ATATTCTATTTTTTCAAACTAAAAAAACACTAAATCGGTCCATACTTATT
TTTGCAGTATGTATAACATTTTGATGACATTGACATGCTAAGCTTTCCCT
TAAAAAAAAAAAAAAAAAA
Genomic location of CT203  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D473 marker 473
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)