SGN Marker C2_At5g09880

SGN-M4731
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299838 (SGN)
125338 (CGN)
---
Capsicum annuumSingleSGN-U205454---
Lycopersicon CombinedSingleSGN-U220137---
Solanum tuberosumMultipleSGN-U246741---
ArabidopsisSingleAt5g09880 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49290)
Chromosome
11
Position
0.16 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46746)
Chromosome
5
Position
68.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41509)
Chromosome
12
Position
50.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43485
Forward primer (5'-3')
AAAACATGTTTGATCCTGCAACTGAG
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
CCTTTGAACTTGGCATCATATTCAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38769)
Chromosome
11
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39915
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27088)
Chromosome
5
Position
3.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11673
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11674
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11675
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13668
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13669
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13670
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13671
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 13672
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13673
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13674
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13675
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13676
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13677
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33185
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33186
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33187
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 33188
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11676
Forward primer (5'-3')
AGGGTCAAGCATATCCATGTGGAC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTTGTGCATGGCTTGTTGAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g09880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4731 marker 4731
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)