SGN Marker C2_At5g62390

SGN-M4732
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle299487 (SGN)
121931 (CGN)
---
Capsicum annuumSingleSGN-U198216---
Lycopersicon CombinedSingleSGN-U218274---
Solanum tuberosumSingleSGN-U244397---
ArabidopsisSingleAt5g62390 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109248)
Chromosome
3
Position
25.70 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49307)
Chromosome
3
Position
47.47 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47247)
Chromosome
3
Position
61.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper Capsicum   
Map version
65 (location: 42692)
Chromosome
3
Position
109.30 cM
Confidence
uncalculated
Protocol
PCR


Pepper Capsicum

Map: Eggplant-COSII   
Map version
63 (location: 42269)
Chromosome
3
Position
62.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43838
Forward primer (5'-3')
GCTAAGGGCTCTCTTCAACAACTTC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41548)
Chromosome
3
Position
63.30 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43524
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38910)
Chromosome
3
Position
75.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40012
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27634)
Chromosome
5
Position
25.07 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12082
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12083
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12084
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12345
Forward primer (5'-3')
TGCTCTGAGAGAACTGGCCATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAACAACTTGAGCCACACCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12346
Forward primer (5'-3')
TGCTCTGAGAGAACTGGCCATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAACAACTTGAGCCACACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12347
Forward primer (5'-3')
TGCTCTGAGAGAACTGGCCATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAACAACTTGAGCCACACCAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12348
Forward primer (5'-3')
TGCTCTGAGAGAACTGGCCATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAACAACTTGAGCCACACCAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12349
Forward primer (5'-3')
TGCTCTGAGAGAACTGGCCATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAACAACTTGAGCCACACCAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 12350
Forward primer (5'-3')
TGCTCTGAGAGAACTGGCCATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAACAACTTGAGCCACACCAGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 500+900
Approximate temperature
55°C
  
PCR data   Exp. ID 13933
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13934
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13935
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13936
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13937
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13938
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13939
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13940
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 13941
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13942
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 33297
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 33298
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 33299
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33300
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33367
Forward primer (5'-3')
TGCTCTGAGAGAACTGGCCATTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGAACAACTTGAGCCACACCAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12085
Forward primer (5'-3')
TGCTACTAACTGTTGATGCCATTGAG
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGGGGGTCGATAACATCAAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, EcoRV, HaeIII, HinfI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: AluI, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g62390  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4732 marker 4732
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)