SGN Marker TG597

SGN-M474

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATTGCAAAGGTTGGTCAGGTATCTGGGAGTGGGTAATGGGAACATGCAAGAAGGATCACTTCGCTGCGACGTCAATATTTCAGTTCGTCC
TATTGGTCAATTAGAGTTTGGTACAAAGGTTTGCATGATCTGCTTTCCGTTTCTATTGCTTTCCCTTATGCATAGGAAATACTAATTTAT
AGCTAGATGATTCAGGCATGAAGATTCTAAATTTTAGTTTGCTTTCCTTTGTGGATGTTTTTCTTTCTTATCTTGATCTGCCATTTTTCT
TGGTGGATGGTTCGGTAAGTTGTGTTTCAAGTGATACATTGGCTCCTATTCCATTGTTCATCTATGCACCACAAAGAATGTCTCCTATAT
AATCTGGTCAATTGACAACTTAATTTAGTGCCAGGCGTAAGTCCAGTTTGGCCATTGCCCATTTATGAAATTCTTGCTTTAGCCTTAAAA
TTAATAAGGGAATTTACTCGTCATTTGAATGTGAAATGTGGTCTATG
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGTAAAACTTGCCACCAAGCTGTATGTATGATGATCTACTACCACTATGTATGGATTTCTGTACGTCC
TAATTAACACGACTAATCTGTGTATATCGATCCCTGTATGAACATGTGAATCTCAGCCCAGCTAGAAACAGTATAGAGAACACCAGAGAG
TTTGTTCCAACTTGTTGAGTCTTTCTTAGCATAAGTCTTCTGTTTCTCAATGATGCCACGATATAGCGGAATGAAAGAAATACCAAAATG
ATTCCCGACTCTCACCAGGTTTGGGCCTGGATTAATCAGAATGCCAATATCTGCTTGCAGCAAGCAAAGCATATCATTCATGGTGCCCCC
AATGTGAACAGTCAGGTTCTTTTTGTCATTGTTGTAGTTGTTTAAAACTTCACTGAAGGTTTGAACCTTGTCGAAGGGGCCTTCAACTTT
CTTTACAATTACACCAGTTGATAGATTTTCTTCAAATATAAACTCATTCGCGTGCACATTCACAACATCCAAACCATCTGATCAC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40106)
Chromosome
5
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9246)
Chromosome
5
Position
95.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG597 was used as an overgo probe on plate 5 [well A10]

Plausible BAC Matches:   P245E05,   P092P05,   P140K15

 Overgo Sequences

A sequence
TGCAAAGGTTGGTCAGGTATCTGG
B sequence
TTCCCATTACCCACTCCCAGATAC
AB sequence
TGCAAAGGTTGGTCAGGTATCTGGGAGTGG
Marker sequence
ATTGCAAAGGTTGGTCAGGTATCTGGGAGTGGGTAATGGGAACATGCAAG
AAGGATCACTTCGCTGCGACGTCAATATTTCAGTTCGTCCTATTGGTCAA
TTAGAGTTTGGTACAAAGGTTTGCATGATCTGCTTTCCGTTTCTATTGCT
TTCCCTTATGCATAGGAAATACTAATTTATAGCTAGATGATTCAGGCATG
AAGATTCTAAATTTTAGTTTGCTTTCCTTTGTGGATGTTTTTCTTTCTTA
TCTTGATCTGCCATTTTTCTTGGTGGATGGTTCGGTAAGTTGTGTTTCAA
GTGATACATTGGCTCCTATTCCATTGTTCATCTATGCACCACAAAGAATG
TCTCCTATATAATCTGGTCAATTGACAACTTAATTTAGTGCCAGGCGTAA
GTCCAGTTTGGCCATTGCCCATTTATGAAATTCTTGCTTTAGCCTTAAAA
TTAATAAGGGAATTTACTCGTCATTTGAATGTGAAATGTGGTCTATG
Genomic location of TG597  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D474 marker 474
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)