SGN Marker CT204

SGN-M475

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTCTTGCAAAGGTGGAGATTCTGGGGATGAGTGCTGTAGAGGGATTAACATCCCGACTCCAAATATGATGGTGGAAGAAGGTAAAGGAGA
GCCCCACAAGGCTGTTATGCATAGTATAAATGGCATCCCGTCTCCTGTTCCGTGCCTCCATGGAGTACCTTGGCCTTTTCCATGGAATGC
TGCAGTTCCTGTGTCGGCTATTTGCCCCATTCCCTTCCCTATGCCATTCTTCCCTACACCTTATTGGAATTGCAGTGTGCCTCCTTGGAG
TAATCCTTGGTTGAGTCCACCTCTGCGAGCTGCAAACGAGAAAACATCAGGTTCTGATCCTACTTCTTCTTTAGGGAAACATTCAAGAGA
GGGGGATTTGCTTAAGCCAAGCAATCCTGGGGGCAAAGAACAATCAGAACAAAAGTATTCAGAGGGGTCTATTTTGGTCCCATAAACATT
GCGGATTGATGATCCTGA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1733065.3e-0759 (12.6% of RFLP seq)+
SGN-U148444468 (100.0% of RFLP seq)+
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132208)
Chromosome
6
Position
106.12 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49327)
Chromosome
6
Position
39.83 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47265)
Chromosome
6
Position
59.89 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42323)
Chromosome
6
Position
85.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39012)
Chromosome
6
Position
54.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9249)
Chromosome
6
Position
93.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9248)
Chromosome
6
Position
50.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT204 was used as an overgo probe on plate 4 [well D10]

Plausible BAC Matches:   P066I09,   P246H13,   P060H01,   P334D13

 Overgo Sequences

A sequence
TCTTGCAAAGGTGGAGATTCTGGG
B sequence
CTCTACAGCACTCATCCCCAGAAT
AB sequence
TCTTGCAAAGGTGGAGATTCTGGGGATGAG
Marker sequence
TTCTTGCAAAGGTGGAGATTCTGGGGATGAGTGCTGTAGAGGGATTAACA
TCCCGACTCCAAATATGATGGTGGAAGAAGGTAAAGGAGAGCCCCACAAG
GCTGTTATGCATAGTATAAATGGCATCCCGTCTCCTGTTCCGTGCCTCCA
TGGAGTACCTTGGCCTTTTCCATGGAATGCTGCAGTTCCTGTGTCGGCTA
TTTGCCCCATTCCCTTCCCTATGCCATTCTTCCCTACACCTTATTGGAAT
TGCAGTGTGCCTCCTTGGAGTAATCCTTGGTTGAGTCCACCTCTGCGAGC
TGCAAACGAGAAAACATCAGGTTCTGATCCTACTTCTTCTTTAGGGAAAC
ATTCAAGAGAGGGGGATTTGCTTAAGCCAAGCAATCCTGGGGGCAAAGAA
CAATCAGAACAAAAGTATTCAGAGGGGTCTATTTTGGTCCCATAAACATT
GCGGATTGATGATCCTGA
Genomic location of CT204  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D475 marker 475
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)