SGN Marker CT131

SGN-M476

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTGGAGTTTCTATCTTCACTTTATAAGTTGCTTCACCTTTACCAACATTAGTAAGGGTCCTCCTGAATTTCTGCTCCAACCAGGTGTAG
TTGCGCTCGATGCTGAATGGGTACAACGCAATGAATGATGGGTAATTGAGATCAGCTGATGGATTTGAGCAGTTGTGGTAATTGGCTGAT
GATCTTGCAAATGTTTTGAACTGCTCTTCCGTGAAATTCAAAGAGCATATAAGATTTATGTAATCTTGTGGAGTGGCATCATATATGAGG
CCGGGATCAAGAGCTTTGTTCGGGTCAACGTGTCCTGATCCCATTTCTAGGGGTGTGGCTACCCTATTATTATCCCTTCTAATAGGATTT
TGAGTATTATCCAAATGGTTTGCTGTGGTCATCATGGCAGAGCGAATAGCTGAAGGACTCCATTCAGGATGCACACTTTTTAGCATTGCT
GCAATTCCAGCAGCATGAGGTGCAGCCATGGATG
Reverse sequence
TGCCAGGGATATTGATGGTCATGGCACACATTGCGCTTCCATCACTGCTGGGAACTTTGCTAAAGGTGCTTCTCATTTTGGATATGCACC
GGGGACAGCAAGAGGGGTTGCTCCACGAGCTAGGATAGCGGTCTACAAGTTTAGCTTTGATGAAGGAACACTATCATCAGATTTAATTGC
TGCTATGGACCAAGCTGTTGCAGACGGTGTTGACATGATATCCATTTCTTATGGATACCGTTTCATTCCCTTGTATGAAGATGCTATATC
AATTGCTTCTTTCGGAGCTATGATGAAGGGAGTATTGGTCTCAGCTTCAGCTGGAAATGAAGGTAGCGGTTCATCTGTAGAAAATGGATC
TCCATGGATCTTGTGTGTGGCATCAGGCCACACTGACAGGAGATTTGGAGGAACTTTGACTTTAGGCAATGGATTAAAAATTAGGGGTTG
GACGTTGTTTCCTGCAAGAGCCTTTGTCAGGGATTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1482671e-17163 (33.7% of RFLP seq)+
SGN-U1482681e-17163 (33.7% of RFLP seq)+
SGN-U1482681e-17105 (21.7% of RFLP seq)+
SGN-U1545892.5e-1874 (15.3% of RFLP seq)+
SGN-U1482674.1e-20101 (20.9% of RFLP seq)+
SGN-U1545892e-34167 (34.5% of RFLP seq)+
SGN-U1433511.3e-35208 (43.0% of RFLP seq)+
SGN-U1433499.4e-86469 (96.9% of RFLP seq)+
SGN-U1433501e-94302 (62.4% of RFLP seq)+
SGN-U1604795e-103296 (61.2% of RFLP seq)+
SGN-U1433564e-165428 (88.4% of RFLP seq)+
SGN-U143357484 (100.0% of RFLP seq)+
SGN-U1468431.9e-31192 (39.5% of RFLP seq)-
SGN-U1468445e-35250 (51.4% of RFLP seq)-
SGN-U1433492.4e-49134 (27.6% of RFLP seq)-
SGN-U1433495e-115328 (67.5% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9252)
Chromosome
1
Position
35.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT131 was used as an overgo probe on plate 14 [well A10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P011D17,   P147A16,   P189A15,   P174F22,   P066A14,   P274O15,   P023M24,   P303I19,   P271M24,   P262J16,   P101L17,   P312G01,   P213N22,   P145M24,   P153K16,   P126J06,   P146C14,   P077B18,   P075M12

 Overgo Sequences

A sequence
AAGGGTCCTCCTGAATTTCTGCTC
B sequence
CAACTACACCTGGTTGGAGCAGAA
AB sequence
AAGGGTCCTCCTGAATTTCTGCTCCAACCA
Marker sequence
TTTGGAGTTTCTATCTTCACTTTATAAGTTGCTTCACCTTTACCAACATT
AGTAAGGGTCCTCCTGAATTTCTGCTCCAACCAGGTGTAGTTGCGCTCGA
TGCTGAATGGGTACAACGCAATGAATGATGGGTAATTGAGATCAGCTGAT
GGATTTGAGCAGTTGTGGTAATTGGCTGATGATCTTGCAAATGTTTTGAA
CTGCTCTTCCGTGAAATTCAAAGAGCATATAAGATTTATGTAATCTTGTG
GAGTGGCATCATATATGAGGCCGGGATCAAGAGCTTTGTTCGGGTCAACG
TGTCCTGATCCCATTTCTAGGGGTGTGGCTACCCTATTATTATCCCTTCT
AATAGGATTTTGAGTATTATCCAAATGGTTTGCTGTGGTCATCATGGCAG
AGCGAATAGCTGAAGGACTCCATTCAGGATGCACACTTTTTAGCATTGCT
GCAATTCCAGCAGCATGAGGTGCAGCCATGGATG
Genomic location of CT131  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D476 marker 476
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)