SGN Marker CT75

SGN-M477

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT75 image not available
Forward sequence
CAGGGGATTGTCTTAGTATCATTTCTCCTTATTTTTCCTTCTTCACCATTCCCCCCCTCTTAATTCTCTTTACTCATAATTCATAAAAAA
ACATGGCTACTGCAGTAAGTGCTGCAGTTTCTCTTCCTTCATCCAAGTCCACCTCCTTTTCCTCTAGAAACTCCATCATCTCTACAGACA
AAATCAACTTCAACAAGGTGCCCTTGTACTACAGAAATGTGTCTGGTGCTAGTAGATTAGTTTCTATCAGAGCCCAAGTGACCACTGAGG
CTCCTGCTAAAGTTGAGAAGATTTCAAAGAAACAGGAGGAAGGTGTGATTGTCAATAAATTCAGGCCAAAGGAACCTTATGTTGGTAGAT
GTCTGCTAAACACTAAGATCACTGGTGATGATGCACCTGGAGAAACTTGGCATATGGTTTTCAGCACTGAGGGAGAGGTCCCATATAGAG
AAGGACAATCCATTGGGGTAATTGCTGATGGTGTTGATGCCAATGGGAAGCCTCACAAGCT
Reverse sequence
CCTTGTAAAGTAGTGAGCTGCTGGTGGGAACACCCAAGAAAAGCCATGCTGTACCGTTGAACTTGTAATCCTCGTGTTTCTCAAAGAACA
TTTTCCACAGGAATGAACGGAAAGGAGCAATTCCAGTTCCAGTGGCAAGCATTATAACGGTGGCATTTGGATCTTTAGGCATGAGCATTT
CTTTGCCTACAGGTCCAGTAATCTTGACCTCTGCTCCAGGCTTCAAGTCACATAAGAAGTTTGAGCAAACTCCTTTAACTTCTTCCCCTT
TGTCATTGGTGTACACAAGCCTCTTGACACACAGGGAAACAGTTTTGGAGTCACCGAAGTCACCAAGGGCACTGCTAGCAATTGAGTACA
ATCTAAGCTTGTGAGGCTTCCCATTGGCATCAACACCATCAGCAATTACCCCAATGGATTGTCCTTCTCTATATGGGACCTCTCCCTCAG
TGCTGAAAACCATATGCCAAGTTTCACCAGGTGCATCATCACCAGTGATCTTAGTGTTTAGCAGACATCTAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1550317.6e-28122 (23.9% of RFLP seq)+
SGN-U143166492 (96.3% of RFLP seq)+
SGN-U1550314e-1150 (9.6% of RFLP seq)-
SGN-U1603302.8e-2151 (9.8% of RFLP seq)-
SGN-U1603303e-2464 (12.3% of RFLP seq)-
SGN-U1603313.7e-42146 (28.0% of RFLP seq)-
SGN-U143166522 (100.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51904)
Chromosome
2
Position
79.92 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42972)
Chromosome
2
Position
52.50 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43972
Forward primer (5'-3')
GAACACCCAAGAAAAGCCAT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AATGGGAAGCCTCACAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9253)
Chromosome
2
Position
71.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9254)
Chromosome
2
Position
26.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CT75 was used as an overgo probe on plate 6 [well G9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCACCTGGAGAAACTTGGCATATG
B sequence
CCTCAGTGCTGAAAACCATATGCC
AB sequence
GCACCTGGAGAAACTTGGCATATGGTTTTC
Marker sequence
CAGGGGATTGTCTTAGTATCATTTCTCCTTATTTTTCCTTCTTCACCATT
CCCCCCCTCTTAATTCTCTTTACTCATAATTCATAAAAAAACATGGCTAC
TGCAGTAAGTGCTGCAGTTTCTCTTCCTTCATCCAAGTCCACCTCCTTTT
CCTCTAGAAACTCCATCATCTCTACAGACAAAATCAACTTCAACAAGGTG
CCCTTGTACTACAGAAATGTGTCTGGTGCTAGTAGATTAGTTTCTATCAG
AGCCCAAGTGACCACTGAGGCTCCTGCTAAAGTTGAGAAGATTTCAAAGA
AACAGGAGGAAGGTGTGATTGTCAATAAATTCAGGCCAAAGGAACCTTAT
GTTGGTAGATGTCTGCTAAACACTAAGATCACTGGTGATGATGCACCTGG
AGAAACTTGGCATATGGTTTTCAGCACTGAGGGAGAGGTCCCATATAGAG
AAGGACAATCCATTGGGGTAATTGCTGATGGTGTTGATGCCAATGGGAAG
CCTCACAAGCT
Genomic location of CT75  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D477 marker 477
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)