SGN Marker TG598

SGN-M478

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG598 image not available
Forward sequence
TTTTTTTTCTGCTTTGATTGGCTGTAGTTGTTTCGTAATATATTAGAAGAGAACAGATTCCATATATGAATAATAGCTATCCAACAGATA
ATTTTTAACTTAAAATCATAAGCACTTCAGAACTTTAGAAAAAATAATTATTCTCTAACCATTTAGTAGAGTGCATCATTATATAATATT
GTTTCCAATTAGCAGCATTTCAATACCATTAGAAAAATGATAGGCCGCATTGCCAAAAGAATGCACATATAACAGCAAGAAATGAAAGAT
CAGATTACAAGAAAGGGAACTCGCTGAAATACAGAATAACAACCTTGGTGGTCTTCATTTTAGCTCAACTCCAAGCACATTAGATATCTC
CATGAAGCTCCAACATAGCACTGCTATAATGAGGCATATGGAAAGTTGGAAAACTAATCACCTGAGAATAAAAGGTACCATCAATAAGAA
GATACAAAAAATCACACGAGTTCAACAACAGAGTGGAACTGAAGGTTGAAAG
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGTACTTGATTAATAGTTCAAACTCCCAGAAAGTTGGAGTAGTCTATCGGTTGTGTACGAATTACCTT
GGGGGATCACAATAGTGGTACCTATAGAGTCTGTTTTATATCTCCATCTGAATGCATTTTTCCAGCCATGACTTTGATATTCCTCGGTAT
ATTGTATATGCATTAGTATGAAATAAGTTCTTATCTCAAGATCCTGAAAGAAGATTCTCCAAGGATCATTATATTATGCCCAAAAAGGGG
ATATTTCTGTGCAAGTAACATCAAATTCATTTACTATCCATAGCAATAGGTTAATTTCTATATTTTTATAGCTTGTTCCTTGTCTGGAAT
AGATTCTCTTTTTTCAGTTTAACCCAAAAATAAGTATCATGTATCAGTTTCAATCTAGGGAGTGGGAGTACAAAGGTTCTTTTTAGACTT
GACACATGATCCTAAAATATATCAGTCTCTTTTATTGAAAATGATATTTTCTTTCTCAATTCTGAAACTTTATGCTAAAACTTTCAACCT
TCAGTTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1580414.1e-54110 (21.9% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53362)
Chromosome
5
Position
12.68 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9255)
Chromosome
5
Position
12.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG598 was used as an overgo probe on plate 5 [well F11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CAACCTTGGTGGTCTTCATTTTAG
B sequence
TGTGCTTGGAGTTGAGCTAAAATG
AB sequence
CAACCTTGGTGGTCTTCATTTTAGCTCAAC
Marker sequence
TTTTTTTTCTGCTTTGATTGGCTGTAGTTGTTTCGTAATATATTAGAAGA
GAACAGATTCCATATATGAATAATAGCTATCCAACAGATAATTTTTAACT
TAAAATCATAAGCACTTCAGAACTTTAGAAAAAATAATTATTCTCTAACC
ATTTAGTAGAGTGCATCATTATATAATATTGTTTCCAATTAGCAGCATTT
CAATACCATTAGAAAAATGATAGGCCGCATTGCCAAAAGAATGCACATAT
AACAGCAAGAAATGAAAGATCAGATTACAAGAAAGGGAACTCGCTGAAAT
ACAGAATAACAACCTTGGTGGTCTTCATTTTAGCTCAACTCCAAGCACAT
TAGATATCTCCATGAAGCTCCAACATAGCACTGCTATAATGAGGCATATG
GAAAGTTGGAAAACTAATCACCTGAGAATAAAAGGTACCATCAATAAGAA
GATACAAAAAATCACACGAGTTCAACAACAGAGTGGAACTGAAGGTTGAA
AG
Genomic location of TG598  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D478 marker 478
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)