SGN Marker CT21

SGN-M48

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT21 image not available
Forward sequence
TTTTTTTTTTTTAGAGAAACAATAATCACCCTTCCCTTTTATTAAATTTAGTCAAATGAAAATACACAAAAATTGATAGTAAATTCTACA
TTTTTATTCCCCAAATTAAATGCGAAATGACATATTTTAGTTCCTTGCACCAACAAGCCTCTCTCTCAAAATCTTCATCCCCATGTACCT
TCCAAGCATCATGACAGTGGCTTGAGGATTAGTGCCAGGTGATTCAATAAATGTAGATCCATCAATAACTCTCAATCCATCAATTCCAAC
AACTTTATAATCCTTATCAACCACTTTCCCAACTTGACAACCTCCATGGTAATGCCATATGGTGACTACAGTGTCAATACAAAATTGTTC
TAAAGAAACAGAGGCACTCAAATGTCTTGGTCGCAAATTGAGTGGAAAAGTTAACATTGTATTAAATAAAGATTGTGCTGTTGTAAAAGG
GTACTTAAAATCGAATAAAGATGTCGATTCTATAACCTCTGCTATTGTTCTCATGCCTTGTACACATCTTTGTAGGTCTCTCGGATCTTT
GAAGTAGTTGAATGTTACAAGTGGA
Reverse sequence
TCATTCTTTCCATTCCTTGTTTCTCTGAGAAAGCCCCATATTCGACGTTTGCGAGAGATGCTACGTCATCACCAAAGGTTATTTCGTTCG
ATTACATCATAATAGGAGGAGGAACTGCTGGTTGTGCATTAGCAGCAACACTCTCACAATCGTTCAATGTTCTGTTATTAGAAAGAGGTG
ACTTACCCTATGGAAACCCAAACATCACAAACATTAACGGTTTCTCAAGCAACTTAGCCAACATTTCTCCGTCATCTCCCTCGCAACTTT
TCATCTCTACAGACGGTGTATTCAACCACCGTGCTCGCGTCTTAGGTGGTGGTTCAGCTATTAATGCGGGGTTCTTTACGAGGGCGAGTG
ATGAGTACGTTAAGAAAGTGGGATGGAATGACAAGTTAGTGAGAGATTCGTATGAATGGGTGGAAAAGAAAGTGGCGTTTGAGCCACAAG
TAAAGCAGTGGCAATCTGCTGTGAAGAATGGTTTGTTGGAAGTGGGAGTGAAACCGGATAATGGTTTTACGTATCAACATTTATATGGGA
CTAAAGTTGGTGGAAGTATATTTGATTCACAAGGACACAGACATACTGCTGCGGATTTGTTGGAGTATGCTAATCCTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1451256.5e-0747 (8.3% of RFLP seq)+
SGN-U1451256.7e-1068 (12.0% of RFLP seq)+
SGN-U1497311.8e-1651 (9.0% of RFLP seq)+
SGN-U1466723.5e-30158 (28.0% of RFLP seq)+
SGN-U149731487 (86.2% of RFLP seq)+
SGN-U1497315.3e-57115 (18.6% of RFLP seq)-
SGN-U149731496 (80.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 7867)
Chromosome
6
Position
8.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT21 was used as an overgo probe on plate 2 [well B5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P195G22,   P190A04,   P117M03,   P054C15,   P145J19,   P099M11,   P103M05,   P306J09,   P108E14,   P273D10

 Overgo Sequences

A sequence
CTTCATCCCCATGTACCTTCCAAG
B sequence
AGCCACTGTCATGATGCTTGGAAG
AB sequence
CTTCATCCCCATGTACCTTCCAAGCATCAT
Marker sequence
TTTTTTTTTTTTAGAGAAACAATAATCACCCTTCCCTTTTATTAAATTTA
GTCAAATGAAAATACACAAAAATTGATAGTAAATTCTACATTTTTATTCC
CCAAATTAAATGCGAAATGACATATTTTAGTTCCTTGCACCAACAAGCCT
CTCTCTCAAAATCTTCATCCCCATGTACCTTCCAAGCATCATGACAGTGG
CTTGAGGATTAGTGCCAGGTGATTCAATAAATGTAGATCCATCAATAACT
CTCAATCCATCAATTCCAACAACTTTATAATCCTTATCAACCACTTTCCC
AACTTGACAACCTCCATGGTAATGCCATATGGTGACTACAGTGTCAATAC
AAAATTGTTCTAAAGAAACAGAGGCACTCAAATGTCTTGGTCGCAAATTG
AGTGGAAAAGTTAACATTGTATTAAATAAAGATTGTGCTGTTGTAAAAGG
GTACTTAAAATCGAATAAAGATGTCGATTCTATAACCTCTGCTATTGTTC
TCATGCCTTGTACACATCTTTGTAGGTCTCTCGGATCTTTGAAGTAGTTG
AATGTTACAAGTGGA
Genomic location of CT21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D48 marker 48
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)